Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

letter

. 2008 May;18(5):717–728. doi: 10.1101/gr.071886.107

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

Copyright © 2008, Cold Spring Harbor Laboratory Press

PMC Copyright notice

Figure 4. — Filled and intact preintegration site sequences for individual nonautonomous piggyBac1_ML elements from M. lucifugus and M. austroriparius, respectively. Target site duplications for each insertion are shaded. (A) Locus 340_3005. (B) Locus primer sequences (5′–3′) for the two loci presented are as follows: Mluc_cont1.015340_3005_L—TTGTACCAAAAGGTGCCAAA, Mluc_cont1.015340_3005_R—TTTCCTCATATACCATCCCATTTT; Mluc_cont1.000939_4755_L—CAAAATAAGGGAGAAAGGAAACA, Mluc_cont1.000939_4755_R—GGGCTGAGAAACAAGATCCA. (Mluc) M. lucifugus; (Maus) M. austroriparius.