Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Different CpG motifs
| ODN | Sequence | Predominant in vitro effects |
|---|---|---|
| 1758 | TCTCCCAGCGTGCGCCAT | Monocyte activation; enhanced NK activity (10) |
| 1812 | TCTCCCAGZGTGZGCCAT | Minimal immunostimulatory effect (10) |
| 1643 | GAGAACGCTCGACCTTCGAT | B cell mitogen (9) |
CpG dinucleotides are underlined; Z indicates 5-methylcytosine in the control ODN with methylated CpGs, 1812. All oligonucleotides were synthesized with phosphorothioate modified backbones to improve their nuclease resistance.
