Skip to main content
. 2008 Apr 10;9:157. doi: 10.1186/1471-2164-9-157

Table 3.

Novel miRNAs

miRNA name (cluster name) mature sequence of novel miRNA reads Predicted precursor of novel miRNA location / comments
hsa-mir-1469 (srclusterF2762) CUCGGCGCGGGGCGCGGGCUCC 1 chr15:94,677,494-94,677,540 (+) / intron of NR2F2
hsa-mir-1251 (srclusterF3130) ACUCUAGCUGCCAAAGGCGCUU 1 chr12:96,388,159-96,388,215 (+) / intron of RMST
hsa-mir-1470 (srclusterF891) GCCCUCCGCCCGUGCACCCCG 1 chr19:15,421,359-15,421,419 (+) / antisense intron of WIZ
hsa-mir-675b (srclusterR1978) CUGUAUGCCCUCACCGCUCAG 3 chr11:1974572-1974628 (-) / star sequence of miR-675
hsa-mir-1471 (srclusterR2035) GCCCGCGUGUGGAGCCAGGUGU 1 chr2:232,582,457-232,582,513 (-) / intergenic
hsa-mir-1468 (srclusterR3487) CUCCGUUUGCCUGUUUCGCUG 1 chrX:62,788,915-62,788,976 (-) / intergenic