Table 2. Primer sequences for the PCR of the five intronic regions known as harbouring frequent SNPs.
| SNP | Localisationa | Restriction enzyme | Primer sequence | Intron length (bp) | PCR product length (bp) |
|---|---|---|---|---|---|
| Intron 2 | T4717580C rs1265035 | BfaI | S: GTAAGGTAGCCCCTTTGTTT As: CTTTCCTGGTCTCTGGTTCT | 31 938 | 185 |
| Intron 3 | T4743257C rs1997833 | MseI | S: TTAGGCCTTAAATGGGATG As: CAAGCTTGCTACAGACTTGA | 14 680 | 163 |
| Intron 6 | T4762170C rs6016511 | MnlI | S: TCCTGTCAGACATTCTAAGTGA As: CCTTTCCATCCAATTTCTACT | 984 | 177 |
| Intron 8 | C4768132T rs6124314 | HinP1I | S: GTGGTAGTTACTCAATAAATGCT As: AGGGCACCTAATTCTACACA | 7903 | 156 |
| Intron 17 | A4799318G rs6129760 | — | S: TCAATTCCTCGTTCTGTTCT As: TTCATCTCCTTGCTTCCTC | 1776 | 152 |
a
This refers to the variations mentioned in databases.