Table 1. Microarray and qRT-PCR analysis of gene transcription comparing mutant and wild-type tissue.

Affymetrix Array Probe ID	Gene	GO: Molecular Function/Biological Process	qRT-PCR Primers (5′ - 3′)	MUT/WT Fold Change
				Whole Placenta Microarray (FDR)	Endothelial Cell–Specific qRT-PCR
1421201_a_at	Trophinin	Cell adhesion/Cell growth and organization	GAACCCACGACCAGAACC – For GCAAAATGGCCACATCTC – Rev	−2.2 (0.00)	−5.4
1448136_at	Enpp2	Hydrolase and nucleotide diphosphatase activity/Chemotaxis; cell motility	CCGACCTGACAATGATGAGA – For AAATCCAAACCGGTGAGATG – Rev	−2.3 (0.00)	−23.1
1417217_at	Magel-2	Protein binding/Regulation of transcription	AACGCTTTGGTGCAGTTTCT – For CTTAGTGTTGGCACGGTTGA – Rev	−2.9 (0.00)	−98.9
1449145_a_at	Caveolin-1	Protein binding/Vasoconstriction; vasodilation; EC proliferation	GGGAACAGGGCAACATCTAC – For AACACGTCGTCGTTGAGAT – Rev	−1.9 (0.00)	−3.6
1423420_at	Adrb1	Receptor activity/Blood pressure regulation; vasodilation	GCTGATCTGGTCATGGGATT – For AAGTCCAGAGCTCGCAGAAG – Rev	−1.9 (0.00)	−8.0
1418788_at	Tie2 (Tek)	Receptor activity/Regulation of angiogenesis and cell migration; cell adhesion	TGAGGACGCTTCCACATTC – For CAACAGCACGGTATGCAAGT – Rev	−1.6 (0.00)	−2.2
1429379_at	Lyve1 (Xlkd1)	Receptor activity; hyaluronic acid binding/Cell adhesion	AGCCAACGAGGCCTGTAA – For CACCTGGGGTTTGAGAAAAT – Rev	+3.6 (0.00)	+4.4
1450883_a_at	CD36	Receptor activity/Cell adhesion; fatty acid and lipid metabolism and transport	GAGTTGGCGAGAAAACCAGT – For GTCTCCGACTGGCATGAGA – Rev	−2.28 (0.01)	−2.9
1418084_at	Neuropilin-1	Receptor activity; VEGF receptor activity/Angiogenesis; cell migration	TGTCCTGGCCACAGAGAAG – For CCAGTGGCAGAATGTCTTGT – Rev	−1.5 (0.02)	−7.4
1435382_at	Necdin	Transcription factor/Cell growth and migration	TGGTACGTGTTGGTGAAGGA – For AACACTCTGGCGAGGATGAC – Rev	−1.8 (0.00)	−7.7
1434939_at	FoxF1	Transcription factor/Vasculogenesis; organ development; ECM organization	GCAGCCATACCTTCACCAA – For GCCATGGCATTGAAAGAGA – Rev	−1.3 (0.03)	−2.9