Table 1.
Parameters for binding of full-length IclR protein to selected oligonucleotides and naturally-occuring DNA sequences
| DNA | Selected sequence | [IclR] needed for 50% binding, nM | Hill number |
| Natural sequences | |||
| aceBAK promoter | AAATGGAAATTGTTTTTGATT | 0.36 ± 0.04a | 1.7 ± 0.2a |
| iclR promoter | AAATGAAAATGATTTCCACGA | 0.9 ± 0.1 | 1.6 ± 0.2 |
| gcl promoter | AGTTGGAAAAATTTTCCAATA | 0.5 ± 0.1 | 1.2 ± 0.1 |
| IclR-selected sequences, full palindromes | |||
| Isolate 8a | AATTGGAAACCGTTTCCAAAG | 1.8 ± 0.2 | 1.4 ± 0.2 |
| Isolate 25 | CAATGGAAATTCTTTCCATTC | 0.5 ± 0.1 | 1.4 ± 0.2 |
| Isolate 26 | AAATGGAAATCCTTTCCAATT | 1.9 ± 0.2 | 1.4 ± 0.2 |
| IclR-selected sequences, half palindromes | |||
| Isolate 7 | TGGTGGAAACTAGGTATGTGC | 6.7 ± 0.3 | 0.7 ± 0.1 |
| Isolate 23 | GGGTGGAAATTGTTATTCAGC | 10.3 ± 0.4 | 0.7 ± 0.1 |
| Synthetic DNA | |||
| 29 bp consensus | AAATGGAAATGATTCCACTA | 0.07 ± 0.03 | 0.9 ± 0.1 |
Bases conforming to the core consensus sequence are underlined. In isolate 8a the random region had expanded to 29 bases during the selection process; in the other isolates, this region had remained at 24 bases.
a Data for aceBAK promotor from Donald et al. (1996).