Table 1.
Unusual TG splice acceptors identified in the human transcriptome
| Intron | 3' Splice site pair | ESTs for unusual 3' splice sites | ||||
| Gene | No. | Length | Distance | Motif | Fraction | No. |
| GNAS | 3 | 7843 | 3 | CTG,CAG| | 0.15-0.62*† | 282 |
| PCGF2 | 1 | 224 | 3 | AAG|ATG, | 0.50 | 4 |
| CNBP | 3 | 168 | 3 | TTGTTG,AAG| | 0.25 | 257 |
| 3 | 168 | 6 | TTG,TTGAAG| | 0.01 | 10 | |
| FBXO17‡ | 3 | 1999 | 3 | CAG|ATG, | 0.14 | 4 |
| C21orf63 | 3 | 9975 | 3 | CAG|ATG, | 0.09 | 2 |
| BRUNOL4 | 6 | 1147 | 3 | CAG|CTG, | 0.07 | 2 |
| PCID2 | 2 | 2162 | 3 | CAG|ATG, | 0.04 | 7 |
| TNNT2 | 1 | 4354 | 3 | TTG,GAG| | 0.04 | 2 |
| CACNA1A | 9 | 2532 | 3 | TTGTTG,GAG| | ?† | - |
| 9 | 2532 | 6 | TTG,TTGGAG| | 0.17† | - | |
| GPBP1 | 9 | 1377 | 4 | CAG|GATG, | 0.03 | 2 |
| KIAA0494 | 1 | 1459 | 5 | TTG,AGCAG| | 0.09 | 2 |
| OSBPL8 | 2 | 36530 | 6 | CTG,TTGTAG| | 0.11 | 2 |
| SAP30 | 1 | 1892 | 6 | CTG,TTTCAG| | 0.04 | 2 |
| DRD2 | 6 | 1485 | 6 | CTG,GTGCAG| | 0.02† | 5† |
| SUV420H2 | 5 | 134 | 7 | CTG,GCTCCAG| | 0.20 | 3 |
| SSRP1 | 1 | 489 | 7 | TTG,AATTCAG| | 0.20 | 16 |
| FREQ | 2 | 16849 | 7 | CTG,CCTCCAG| | 0.04 | 2 |
| IL21 | 3 | 2753 | 8 | TTG,ATTTCTAG| | 0.13 | 2 |
| RYK | 7 | 3107 | 9 | TTG,GCTCCTTAG| | 0.77 | 27 |
| DLG4 | 5 | 131 | 9 | CTG,GAGTTGCAG| | 0.62 | 8 |
| SMARCA4 | 29 | 6174 | 9 | TTG,ACCCTGAAG| | 0.41 | 34 |
| FBXL10 | 15 | 177 | 9 | TTG,GCCTACAAG| | 0.21 | 3 |
| HNRPR | 7 | 2839 | 9 | TTG,GTTTAACAG| | 0.13 | 15 |
| RRAD | 1 | 214 | 9 | CTG,ATCCCCTAG| | 0.06 | 2 |
| TGM1 | 6 | 454 | 10 | CTG,TCCTGGGCAG| | 0.13 | 2 |
| ALAS1 | 11 | 1599 | 11 | CTG,TTTCTCCTCAG| | 0.04 | 5 |
| ARS2 | 18 | 182 | 12 | TTG,TACTCCCCCCAG| | 0.74 | 75 |
| PCBP2 | 7 | 1337 | 12 | CTG,ACTCTCTCCCAG| | 0.43 | 169 |
| PTPN11 | 10 | 4269 | 12 | TTG,GCTCTACTCCAG| | 0.33 | 3 |
| MSH5 | 6 | 164 | 12 | CTG,ATCCCCTCCCAG| | 0.25 | 5 |
| SYTL2 | 9 | 1259 | 13 | TTG,CCCTCCTGAGTAG| | 0.09 | 3 |
| TOMM40 | 1 | 95 | 16 | CTG,ACCTCTCCCCTAGCAG| | 0.07 | 2 |
| MARK3 | 3 | 20478 | 17 | TTG,TTTGTTTTTTTTTTTAG| | 0.07 | 3 |
| BAT3 | 6 | 832 | 18 | CTG,ACTCTCCCCTACCTTCAG| | 0.01 | 1 |
| SH3D19 | 6 | 838 | 21 | TTG,GTTTTGTTTTGGTCTCGTCAG| | 0.07 | 1 |
| LOC346653 | 1 | 3097 | 27 | CTG,ACCCATGTACCTGAGGCTGATTTCCAG| | 0.60 | 3 |
| ACAD9 | 10 | 253 | 28 | TTG,TTTCTTGTGTTTTTTCTGAACACTCCAG| | 0.09 | 4 |
Entries in bold have RefSeq transcripts supporting the unusual TG acceptor site. Each TG splice variant is supported by at least two ESTs and at least 3% of all covering ESTs, except for some RefSeq-supported cases, CACNA1A [24,35], DRD2 [19] and BAT3. In the 'Motif' column, a vertical line (|) indicates a canonical splice site, and a comma (,) marks the TG splice site. Splice ratios are given as absolute EST counts (No.) as well as the fraction of TG splice variants. A question mark indicates that an explicit fraction is not given in the referenced article, although the authors performed quantitative experiments. *EST ratio depends on the exon junction; the upstream exon 3 may be skipped. †Splice variants were previously quantified by others: GNAS [16,26], CACNA1A (splice ratio cited from [24,35]), DRD2 (splice ratio cited from [19]). ‡Alternative splicing at FBXO17 intron 3 was not experimentally reproducible in this study.