Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for whole mtgenome amplification at GGI
| Primer name | Mtgenome location | Primer sequence 5' – 3' |
| Mt12s long R | 1135 | ccagaacactacgagccacag |
| Mt12s long F | 1076 | gtgttatcccagtttgggtcttagcta |
| 617F | 617 | gtttagacgggctcacatcacc |
| 6027R | 6027 | cagctcggctcgaataaggag |
| 5819F | 5819 | tcggagctggtaaaaagaggcctaac |
| 11783R | 11783 | gatgcgactgtgagtgcgttcgtag |
| 11268F | 11268 | ccctaggctcactaaacattctac |
| 731R | 731 | tagagggtgaactcactggaa |
