Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Mutation Group List Screen in Artificial Example II. Mutation group list screen as a result of our procedure, for the case of 3-point mutations (the example is for the sequence CCGGAAGAGGGGGACAACCCGGGGAAACUCGGGCUAAUCCCCCAUGUGGACCCGCCCCUUGGGGUGUGUCCAAAGGGCUUUGCCCGCUUCCGG).
