Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Secondary Structure Drawings for the Wild-type and Mutant. Secondary structure drawings for the wild-type and the mutant as a consequence of applying the rearranging point mutation found by our method, for the example in Figure 1 (the example is for the sequence UGCCUGCCUCUUGGGAGGGGC).
