Figure 7.
Input Screen of Artificial Example I. Input screen of our procedure for an artificial example (the example is for the sequence CCUUAACCAGCAAAAACUGCUGG).
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.