Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Output Screen of a Rearranging Mutation in Artificial Example I. Output screen of our procedure for the rearranging mutation A15G-U20G with the secondary structure drawings for the wild-type and the mutant, including additional measures (the example is for the sequence CCUUAACCAGCAAAAACUGCUGG).
