Table 1. Primer sequences and PCR conditions used to evaluate the expression of the transcripts indicated.
| Genes | Primers (5′–3′) | Position in the mRNA | Product size (bp) | Denaturing temperature and time (s) | Annealing temperature and time (s) | Extension temperature and time (s) | Number of cycles |
|---|---|---|---|---|---|---|---|
| gadd45 | F: AGAACGACATCAACATCCTGC | 534–554 | 144 | 95°C (30) | 60°C (30) | 72°C (60) | 35 |
| R: AATGTGGATTCGTCACCAGCA | 657–677 | ||||||
| gadd153 | F: AACCAGCAGAGGTCACAAGC | 377–396 | 217 | 95°C (30) | 60°C (30) | 72°C (60) | 33 |
| R: AGCCGTTCATTCTCTTCAGC | 574–593 | ||||||
| β-actin | F: ATCATGTTTGAGACCTTCAACAC | 437–459 | 822 | 94°C (40) | 63°C (60) | 72°C (60) | 29 |
| R: TCTGCGCAAGTTAGGTTTTGTC | 1237–1258 |
All templates were initially denatured for 5 min at 95°C and the amplicon was extended at a final extension temperature of 72°C for 7 min.