Table 1. Primer sequences and PCR conditions for the detection of mRNA expression of the indicated genes in NE gastrointestinal tumour cells.
| Genes | Primers (5′–3′) | Position in the mRNA | Product size (bp) | Denaturating temperature and time (s) | Annealing temperature and time (s) | Extension temperature and time (s) | Number of cycles |
|---|---|---|---|---|---|---|---|
| EGFR-1 | F: TCCTCCCAGTGCCTGAATAC | 3442–3462 | 240 | 94°C (40) | 63°C (60) | 72°C (60) | 30 |
| R: TAATTTGGTGGCTGCCTTTC | 3682–3663 | ||||||
| EGFRvIIIa | F: GGCTCTGGAGGAAAAGAAAG | 255–274 | 226 | 94°C (40) | 63°C (60) | 72°C (60) | 30 |
| R: TGATGGAGGTGCAGTTTTTG | 1282–1263 | ||||||
| IGRR-β1 | F: GAAGTGGAACCCTCCCTCTC | 1932–1951 | 241 | 94°C (40) | 63°C (60) | 72°C (60) | 30 |
| R: GTTCTCGGCTTCAGTTTTGG | 2172–2153 | ||||||
| β-actin | F: ATCATGTTTGAGACCTTCAACAC | 437–459 | 822 | 94°C (40) | 63°C (60) | 72°C (60) | 30 |
| R: TCTGCGCAAGTTAGGTTTTGTC | 1237–1258 |
a
EGFRvIII does not possess an mRNA-sequence distinct from the EGFR-1 sequence, but Exons 2–7 are missing. Using the indicated primers, EGFRvIII is characterised by a product of 226 bp size, while the wild-type receptor is recognised with a bp product of 1028 bp.
All templates were initially denaturated for 5 min at 95°C and the amplification was extended at a final extension temperature of 72°C for 7 min.