Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of PCR primers used in this study
| Primer | Sequence | Reference | Primer combination for PCR fragment amplification (length [bp])a |
|---|---|---|---|
| 1F-Biotin | AACCTGGTTGATCCTGCCAGT | 22 | 1F-Biotin + 1528R (1,800) |
| 690 F-Biotin | TCAGAGGTGAAATTCTTGGAT | 7 | 690F-Biotin + 1528R (900) |
| 690 R | ATCCAAGAATTTCACCTCTGA | 7 | 1F-Biotin + 690R (900) |
| 528F-Biotin | GCGGTAATTCCAGCTCCAA | 7 | 528F + 1528R (1,200) |
| 1528R | TGATCCTTCTGCAGGTTCACCTAC | 22 |
Primers in boldface were used to amplify the truncated version of the 18S rRNA gene.
