Skip to main content
. 2008 May 19;9:20. doi: 10.1186/1471-2172-9-20

Figure 2.

Figure 2

Regulation of RORγt expression by Id1 and E47. (A) Real-time reverse transcriptase-PCR assays were performed using RORγt or β-actin specific primer sets on cDNA samples from vector or Id1 transduced 16610D9 cells. The primer sequences for RORγt are GTGTGCTGTCCTGGGCTACC and AGCCCTTGCACCCCTCACAG. Those for β-actin are GGCTGTATTCCCCT CCATCG and CCAGTTGGTAACAATGCCATGT. The Ct values of RORγt were normalized against those of β-actin. Data are presented relative to the normalized RORγt level in Id1 expressing cells, with standard deviations obtained from at least three data points for each sample. (B) RT-PCR assays were conducted on serially diluted cDNA samples of primary thymocytes transduced with vector or Id1-expressing retroviruses.