Table 3.
Region no. | ORFa | Difference from WGF on the gel | Size of sequenced region (nt)b | Left coordinatea | Right coordinatea | Newly found changes | Confirmation of SNPs identified by CGSc |
1 | TP0124–TP0134 | insertion | 3245 + 1255 insertion | 145858 | 149102 | 1255 nt insertion, 2 nt deletion | - |
1362 | 149563 | 150924 | - | - | |||
252 | 151648 | 151899 | - | - | |||
3465 | 152043 | 155507 | 1 nt insertion | 2 SNPs | |||
2 | TP0135–TP0138 | deletion | 662 | 155686 | 156347 | - | (+ 64 nt deletion as in Table 1) |
894 | 158391 | 159284 | 1 nt deletion | ||||
3 | TP0433–TP0434 | insertion | 481 + 419 insertion | 461058 | 461538 | insertion of 7 repeats of 60 nt region altogether 14 repetitions, consensus sequence of the repeat CGTGAGGTGGAGGACGYGCCGRRGGTAGTG GAGCCGGCCTCTGRGCRTGARGGAGGGGAG | - |
4 | TP0468–TP0471 | deletion | 3571 | 495308 | 498878 | 2 nt deletion + 1 nt insertion + deletion of seven 24 nt repetitions, consensus sequence of the repeat CTCCGCCTCCTTGCGCCGGGCTTC | 1 SNP |
nt – nucleotide; SNP – single nucleotide polymorphism; aas described in [3]; bregions previously described in Table 1 were excluded; cSNPs identified using CGS in these regions were verified by DDT sequencing.