Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
qPCR assays.
| Gene | Forward primer | Reverse primer | Universal Probe Library probe |
| STI, At2g02480 (target gene) | agctgagtttgctgggaaaa | ttttcatctgaaacaacaccaac | #9 (Arabidopsis) |
| H3.2, At1g13370 (target gene) | aaccgtcgctcttcgtga | ttggaatggaagtttacggttc | #99 (Arabidopsis) |
| PP2A, At1g13320, (reference gene1)) | ggagagtgacttggttgagca | cattcaccagctgaaagtcg | #82 (Arabidopsis) |
1) [67]
Shown are the analyzed genes, sequences of the primers and the identifier of the corresponding Universal ProbeLibrary probes.
