Table 1.
Inducible promoter motifs in P. luminescens in presence of insect larvae homogenate
| Clone No. | Insert/size | Fluorescence Induction | No. of identical clones | Intergenic region | Identified promoter motif within the DNA-insert and homology to promoter motif of intergenic regions, [-35 region, -spacer-, -10 region] |
| 1 | plu1165 (320 bp) | 12.7-fold (± 3.0) | 1 | No | ttatttcgccagattattactgacaatat(insert) |
| tgatttccatcattgatcgctaacaatat (plu3479) | |||||
| ttatttttaaaaaataaaa-tgacaatag (plu2400) | |||||
| ttatttgtccgtcgttat--tgacaacat (plu3567) | |||||
| ttatttttggctatttaa--taacaatat (plu3608) | |||||
| 2 | rpoH (71 bp) | 3.2-fold (± 0.3) | 1 | no | ttgttaaagttgcaac-aactaaag (insert) |
| gtgttagtgttaataa-aactaaaa (plu1672) | |||||
| tagttaaccacggcgaaaactaaag (sucA) | |||||
| atgttaatttatggtt-aactaaaa (plu1864) | |||||
| 3 | plu0097 (385 bp) | 2.8-fold (± 0.1) | 1 | no | tctattggggacgggcgtcc-tggtttgat (insert) |
| tcaatttgtcattttggctaatggtttgat (hutU) | |||||
| 4 | plu1880/plu3515-plu3516 (243 bp) | 3.5-fold (± 0.2) | 1 | no | ttaaagagttgaattcagttatttaaat (insert) |
| ttgaaggataacgggta--tatttaaat (plu4122) | |||||
| 5 | plu1375 (376 bp) | 4.3-fold (± 1.2) | 1 | no | ttgatgtggattacgtggtt--gattatttt (insert) |
| ttgattagcctgaattacaggggattatttt (plu1463) | |||||
| 6 | plu4187 (> 1000 bp) | 10.1-fold (± 1.8) | 1 | no | ttgattcgacgatatt-ttttatatt (insert) |
| ttaatttaaatggtt--ttttatatt (plu1645) | |||||
| ttgattagccaaataatttttatctt (plu2652) | |||||
| ttgatttctttgtgt--tattatatt (plu2790) | |||||
| 7 | fadL (440 bp) | 6.4-fold (± 3.3) | 1 | no | tttactaaacaaaactgcaccgtc--tttttttct (insert) |
| tttactaagcgcgttgtttactcattgttttttct (spr) | |||||
| tttactggatgatacacggtgctt--ttttttgct (plu4229) | |||||
| 8 | tdh (> 900 bp) | 10.3-fold (± 3.9) | 2 | no | tcgccagacacccgatcaccaa-ttttaaaac (insert) |
| tcgacataatcagctaacaattattttgaaac (mlc) | |||||
| tctccatttcattggaagggaagctttaaaac (tccC1) | |||||
| 9 | plu0846/ppsA (plu2628) (> 1000 bp) | 13.6-fold (± 5.3) | 1 | no | ttgcaggtgcaggagcaggagaaaccgc--ggtttaaat (insert) |
| ttgcatgttgtaaaatattacaata------ggtttacat (plu1012) | |||||
| ttgcatgttgtaaaatattacaata------ggtttacat (plu1017) | |||||
| ttgccgtcgcgatgcatcttgaaatccatagggtataaat (ISPlu16A) | |||||
| 10 | plu4479/adhC (> 1000 bp) | 7.9 (± 3.4) | 1 | no | ttcactctgcttaaggtatt-----tgatgtact (insert) |
| tttactctcttgcgtccgactatcgtgatgtaca (plu1579) | |||||
| 11 | plu1949-plu1950 (944 bp) | 10.2-fold (± 4.6) | 1 | yes | tttatgccggttgcattaattcataaaaat (insert) |
| tttatgccggttgcattaattcataaaaat (plu1950) | |||||
| 12 | plu3608-plu3609 (> 1000 bp) | 4.5-fold (± 0.3) | 1 | yes | ttgttaaaaaatcgttatttttggctatttaat (insert) |
| ttgttaaaaaatcgttatttttggctatttaat (plu3608) | |||||
| 13 | plu2635/plu0847 (101 bp) | 13.6-fold (± 5.3) | 1 | no | ttgcaggtgcaggagcaggagaaaccgcggtttaaat (insert) |
| 14 | agaR-agaZ (961 bp) | 3.3-fold (± 0.3) | 1 | yes | ttgaatctcaaccctatttagtct (insert) |
| ttgaatctcaaccctatttagtct (agaZ) | |||||
| 15 | plu3688-plu3689 (> 1000 bp) | 4.0-fold (± 0.4) | 1 | yes | ttatcagaccatccggcagggcaaggggaataaa (insert) |
| ttatcagaccatccggcagggcaaggggaataaa (plu3688) | |||||
| ttatcaacgggctgttggtttaaa-ggaaataaa (plu2604) | |||||
| 16 | plu0643 (855 bp) | 3.7-fold (± 0.8) | 1 | no | tggcctgcccgaccaccgattggatatatt (insert) |
| ttgccttgtccctgtcaga--ggatgtatt (plu1165) | |||||
| 17 | glnD (474 bp) | 6.9-fold (± 2.1) | 1 | no | tcgaacaccgttcacgaatatataat (insert) |
| tccaaccaaattgccg-atatttaat (eutA) | |||||
| 18 | walW (127 bp) | 3.2-fold (± 0.3) | 1 | no | ttaattgaatcgttgagttgtgatact (insert) |
| tcaatttggtaatacaacagtgatact (plu0801) | |||||
| ttaaatatgccagtgtagtctgatact (plu2809) | |||||
The clones were identified by DFI and the sequence upstream the reporter gene was determined by DNA-sequencing. Fluorescence induction factors were determined by three independent measurements, experimental standard deviation is given in the brackets. The promoter motifs were identified with the Softberry BProm analysis tool and homologous promoter motifs were searched within the intergenic regions of the P. luminescens genome. The -10 and the -35 regions are highlighted in bold, and the mismatches compared to the identified promoter motifs are highlighted in italics. The genes downstream of the promoter motifs are marked.