Table 1.
RNase T1 digestion products of E. coli tRNATyrII arising from data in Figure 2. Sequences listed are those that map to the known sequence of tRNATyrII or tRNA signature products [24] for contaminating E. coli tRNAs. ‘>p’ represent 2′-3′ cyclic phosphate digestion products. Modified nucleosides are defined below.
tRNATyrII sequence: 5′pGGUGGGG[s4U]UCCCGAGC[Gm]GCCAAAGGGAGCAGACUQUA[ms2i6A]AΨCUGCCG UCACAGACUUCGAAGG[m5U]ΨCGAAUCCUUCCCCCACCACCA(OH)-3′
| tRNATyrII RNase T1 fragment | Calc m/z | (Fig. 2a)
Exp m/z |
(Fig. 2b)
After Reaction with CMC (n = # CMC units) |
|---|---|---|---|
| CCGp | 972.2 | 972.3 | |
| CAGp | 996.2 | 996.2 | |
| AAG>p | 1002.2 | 1002.2 | |
| AAGp | 1020.2 | 1020.2 | |
| C[Gm]Gp | 1026.2 | 1026.2 | |
| m5UΨCG>p | 1275.1 | 1275.0 | |
| m5UΨCGp | 1293.1 | 1293.0 | 1544.3 (n = 1) |
| ACUUCG>p | 1895.2 | 1894.6 | |
| ACUUCGp | 1913.2 | 1913.0 | 2165.7 (n = 1) |
| UCACAGp | 1936.3 | 1935.9 | |
| CCAAAGp | 1959.3 | 1959.2 | |
| ACUQUA[ms2i6A]AΨCUG>p | 4079.6 | 4080.8 | 4332.6 (n = 1) |
| ACUQUA[ms2i6A]AΨCUGp | 4097.6 | 4097.6 | 4350.9 (n = 1); 4601.0 (n = 2) |
| RNase T1 Signature Ions (tRNA) | Cal m/z | (Fig. 2a)
Exp m/z |
(Fig. 2b)
After Reaction with CMC (n=#CMC units |
|
| |||
| AAAGp (Ser) | 1349.2 | 1349.1 | |
| U[m7G]UUGp (Trp) | 1639.2 | 1638.6 | |
| CCCCCGp (Trp) | 1887.3 | 1887.5 | |
| UCAAAAGp (Ser) | 2289.3 | 2289.3 | |
| A[ms2i6A]AACCGp (Ser) | 2402.3 | 2402.3 | 2653.8 (n = 1) |
| CCACCCCA(OH) (His) | 2425.4 | 2425.2 | |
| UCUCUCCGp (Trp) | 2500.3 | 2500.4 | |
| UUCAADDGp (Trp) | 2553.3 | 2553.2 | 2805.5 (n = 1) |
| U[Cm]UCCA[ms2i6A]AACCGp (Trp) | 3943.6 | 3943.6 | 4195.7 (n = 1) |
Modified Nucleosides
Ψ: pseudouridine
Cm: 2′-O-methylcytidine
D: Dihydrouridine
Gm: 2′-O-methylguanosine
m7G: 7-methylguanosine
I: inosine
ms2i6A: 2-methylthio-N6-isopentenyladenosine
Q: queuosine
m5U: 5-methyluridine
s4U: 4-thiouridine