Skip to main content
. 2008 May 9;74(13):4012–4021. doi: 10.1128/AEM.02324-07

TABLE 1.

Primers used in cloning and ecotype-specific qPCR of pufMa

Target Samples Forward primer Reference Reverse primer Reference Length (bp)b Temp (°C)c
All pufM genes River, Dec. 2001 pufLF (CTKTTCGACTTCTGGGTSGG) 24 pufM750R (CCCATGGTCCAGCGCCAGAA) 1 1,500 58
All pufM genes River, Aug. 2002 pufLF 24 pufM750R 1 1,500 58
All pufM genes River, Aug. 2002 cDNA pufM557F (CGCACCTGGACTGGAC) 1 pufM750R 1 233 58
All pufM genes Bay, Aug. 2002 pufM557F 1 pufM_WAW (AYNGCRAACCACCANGCCCA) 40 277 56
Rhodoferax-like pufM genes All qPCR samples RfxF2 (TGGACGGCCGCATTCTCA) This study RfxR2 (GCTCAATTTCGCGTTCACCACCAA) This study 156 60
Rhodobacter-like pufM genes All qPCR samples RbaF1 (TGGACGAACCTGTTCAGC) This study RbaR1 (CAACTCGCGGTCGCC) This study 152 50
gammaproteobacterial pufM genes All qPCR samples DelMGF1 (ACCGCCGCCTTCTCCAT) This study DelMGR1 (CTAGCTCCCGATCGCCACCATA) This study 151 57
16S rRNA genes, all bacteria All qPCR samples BACT1369F (CGGTGAATACGTTCYCGG) 36 PROK1541R (AAGGAGGTGATCCRGCCGCA) 36 192 60
a

The sequence of each primer is next to the name in parentheses.

b

PCR product length in base pairs.

c

Annealing temperature.