TABLE 2.
Oligonucleotides used in this study
| Primer | Description | Sequence (5′→3′)a |
|---|---|---|
| Construction primers | ||
| PCR-1 | PCR-1:5′ClaI-3′SacI fragments | |
| A-Cla-f | Constant forward primer for PCR-1, the start is 167 bp upstream of yadA start codon | TTTTAAAGATCGATTAGTGCTGT |
| A-993-r | Constant reverse primer for PCR-1, the end is at bp 993 (T331) of yadA | CACGAGCTCTGTGTATTGATTCGATTCACGG |
| PCR-2 | PCR-2:5′SacI-3′SacI fragments | |
| A-1000-f | Forward primer for the yadA(D332L, H333E) insert, the start is at bp 1000 (=K334) of yadA | GGGGAGCTCAAATTCCATCAACTTGACAACC |
| A-1269-r | Reverse primer for yadA(D332L, H333E)-insert, the end is at bp 1269 (yadA stop codon) | ATTGAGCTCTTACCACTCGATATTAAATGATG |
| EibA-916-f | Forward primer for the eibA insert, the start is at bp 916 (L306) of eibA | GTCGAGCTCCTGGACAGCCAGCAGCGCCAG |
| EibA-1179-r | Reverse primer for the eibA insert, the end is at bp 1179 (eibA stop codon) | ATTGAGCTCTTAAAACTCGAAGTTCACACCA |
| UspA1-2224-f | Forward primer for the uspA1 insert, the start is at bp 2224 (Q742) of uspA1 | GACGAGCTCCAGGGTCAGCATTTTAATAATC |
| UspA1-2499-r | Reverse primer for the uspA1 insert, the end is at bp 2499 (uspA1 stop codon) | TATGAGCTCTTATTTCCAGCGGTAACTGCCA |
| Hia-3025-f | Forward primer for the hia insert, the start is at bp 3025 (Q1009) of hia | AACGAGCTCCAAGTCAATAATCTTGAGGGCAA |
| Hia-3297-r | Reverse primer for the hia insert, the end is at bp 3297 (hia stop codon) | ATTGAGCTCTTACCACTGGTAACCAACACC |
| PCR-3 | PCR-3:5′SacI-3′SphI fragments | |
| A-1270-f | Constant forward primer for PCR-2, the start is at bp 1270 of yadA, directly behind the yadA stop codon | CGCGAGCTCTATCATTTAGAAGTTAACAAGTCT |
| A-Sph-r | Constant reverse primer for PCR-3, the end is 569 bp after the yadA stop codon and 30 bp after a SphI site | GTCAATACAGAGATAGAACAGCT |
| PCR mutagenesis | ||
| Mutagenesis primers | ||
| U-2308-f | Forward mutagenesis primer, used for yadA-uspA1-2 together with the primer A-Sph-r; start: bp 2308 of uspA1 | TTACCATCGCCCAGTAGAGCAGGTGAGCAT |
| A-U-1083-r | Reverse mutagenesis primer, used for yadA-uspA1-2 together with the primer A-Cla-f; end: bp 1083 of yadA | TGCTCTACTGGGCGATGGTAAGCTGTTTAAAGC GGCTGAA |
| A-U-2329-f | Forward mutagenesis primer, used for yadA-uspA1-3 together with the primer A-Sph-r; start: bp 2329 of uspA1 | TTGTTCCAGCCATATGGTGTGGGTGAGCATCATGTCTTATTTG |
| A-1104-r | Reverse mutagenesis primer, used for yadA-uspA1-2, together with the primer A-Cla-f; end: bp 1104 of yadA | CACACCATATGGCTGGAACA |
| Standard primers | ||
| A-Cla-f | See PCR-1, here used for yadA-uspA1-2 and yadA-uspA1-3 | |
| A-Sph-r | See PCR-3, here used for yadA-uspA1-2 and yadA-uspA1-3 |
a
Restriction sites are indicated by an underscore. For the mutagenesis primers, the overlapping part is indicated by an underscore.