Skip to main content
. 1998 Dec 8;95(25):14652–14657. doi: 10.1073/pnas.95.25.14652

Figure 3.

Figure 3

In vitro transcription of rrnB P1 promoter derivatives with wild-type or α-mutant (αΔ235 or R265A) RNAPs. The consensus UP element-rrnB P1 promoter contains the sequence of the 4192-UP element, 5′AAAATTTTTTTTCAAAAGTA from −57 to −38 (25). Transcripts from the RNAI and rrnB P1 promoters are indicated by arrows. Plasmid templates were pRLG2230 [−UP; rrnB P1 (−41 to +50), Fig. 1], pRLG4238 [+UP; rrnB P1 (−66 to +50), (25)], pRLG3278 [UP element 4192-rrnB P1; (25)], pRLG4268 (four A-tract-rrnB P1; Fig. 1), and pRLG4269 (two A-tract-rrnB P1; Fig. 1).