FIGURE 2.

DNA binding capacity of DLX3^WT and DLX3^TDO. EMSA were performed to compare the capacity of DLX3^WT and DLX3^TDO to bind DNA. A, recombinant V5DLX3^WT and V5DLX3^TDO were produced in E. coli, purified, and different amounts of protein were analyzed in EMSA using the Dlx3 consensus probe (GGGGGATAATTGCTGG). The inset on the left-hand side shows a Western blot analysis of both recombinant proteins using anti-V5 antibody. B, V5DLX3^WT and V5DLX3^TDO were in vitro transcribed/translated (IVTT) from pet15b-V5DLX3^WT and pet15b-V5DLX3^TDO (in vitro transcribed/translated, reticulocyte lysate system) and analyzed by EMSA using a probe containing a Dlx3 binding site previously identified in the Runx2 promoter. Empty vector (pet15b, EV) was used as a control. Excess unlabeled probe were used for self-competition (SC) and anti-V5 antibody was used for supershift assays. Asterisks, free radiolabeled probe; arrows, protein-DNA complexes; arrowheads, antibody-protein-DNA complexes. C, Saos2-Tet-Off cells transfected with pBi-GFP, pBi-V5DLX3^WT/GFP, pBi-V5DLX3^TDO/GFP, or pBi-V5DLX3^WT/FlagDLX3^TDO were grown with or without doxycycline for 48 h. Nuclear extracts were harvested and EMSA was performed using the Dlx3 consensus probe. D, recombinant V5DLX3^WT and V5DLX3^TDO were analyzed by EMSA using different probes known to bind Dlx3: a probe containing the Dlx3 consensus binding site determined by SELEX (GGGGGATAATTGCTGG), a probe containing the Dlx3 binding site identified in the osteocalcin (OC) promoter (GGGCCCCCAATTAGTCCTCCC), and a probe containing the junctional regulatory element (JRE) present in the promoter of the glycoprotein hormone α subunit expressed in the placenta. Anti-V5 antibody was used for supershift assays.