Table 1.

Primers used in the generation of PCR products that served as templates in in vitro transcription. Numbering starts from the beginning of 3′-UTR

AT1R 3′-UTR sense primers (number denotes the first nucleotide of the 3′-UTR included in the oligo)
1	TAATACGACTCACTATAGGG catgttc gaaacctgtc cataaagtaa ttttgtgaaa gaagg.
100	TAATACGACTCACTATAGGG gaattga aggagaaaat gcattatgtgg
118	TAATACGACTCACTATAGGG cattatgtg gactgaaccg acttttctaa
121	TAATACGACTCACTATAGGG tatgtg gactgaaccg acttttctaa
150	TAATACGACTCACTATAGGG tctgaac aaaagctttt ctttccttttgcaacaagac
300	TAATACGACTCACTATAGGG agcctgc ttttgtcctg ttatttttta tttccacata aagg
600	TAATACGACTCACTATAGGG gtataat ggtgttacta aagtcacata taaaagttaa ac
AT1R 3′-UTR antisense primers (number denotes the last nucleotide included in the oligo)
100	ctgaaaagta gctaatgctc atttggtagt gaag
200	tgtggctttgctttgtcttgttgc
250	attcatcgagtttctgacattgttcttcgagcagcc
300	cagtaaaatt tctcaaatca acacattcat cgagtttc
600	attgttttgg cagtgtaaac ctataagaca caggttg
857	aaacaggaag gcatacttta tgatatataa tctttttaccac
Control (part of the luciferase coding region)
S	TAATACGACTCACTATAGGG gcgccattctatccgctggaagatggaacc
AS	cgcccaacaccggcataaagaattgaagag