Table 1. Distribution of the 11973G/A mitochondrial heteroplasmy in 20 isopod crustacean species.
SUBORDER, Family | Species | Origin | Na | 11973b | Assayc | PCR primersd |
FLABELLIFERA | ||||||
Sphaeromatidae | Dynamene bidentata | France | 2 | G | F, D | VF2/VR2 |
ONISCIDEA | ||||||
Ligiidae | Ligia oceanica | France | 3 | G | F, R, D | VF1/1737ND |
Philosciidae | Chaetophiloscia elongata | France | 2 | G | F, R, D | VF1/1737ND |
Philoscia muscorum | France | 2 | G | F, R, D | VF1/1737ND | |
Agnaridae | Hemilepistus reaumuri | Tunisia | 3 | G/A | F, R, D | VF2/VR2 |
Armadillidae | Armadillo officinalis | Turkey | 2 | G/A | F, R | VF2/VR2 |
Cubaris murina | Guadeloupe | 2 | G/A | F, R, D | VF2/VR2 | |
Armadillidiidae | Armadillidium assimile | France | 3 | G/A | F, R, D | 2138ND/1737ND |
Armadillidium depressum | France | 3 | G/A | F, R, D | 2138ND/1737ND | |
Armadillidium nasatum | France | 2 | G/A | F, R, D | VF1/1737ND | |
Armadillidium vulgare | Brazil, France, Greece, Tunisia | 26 | G/A | F, R, D | 2138ND/1737ND | |
Balloniscidae | Balloniscus sellowii | Brazil | 1 | G/A | F, R, D | VF2/VR2 |
Cylisticidae | Cylisticus convexus | France | 3 | G/A | F, R, D | VF2/VR2 |
Platyarthridae | Platyarthrus hoffmannseggii | France | 1 | G/A | F, R | VF2/VR2 |
Platyarthrus caudatus | Italy | 1 | G/A | F, R | VF2/VR2 | |
Porcellionidae | Porcellio gallicus | France | 3 | G/A | F, R, D | VF2/VR2 |
Porcellio spinicornis | France | 2 | G/A | F, R, D | VF2/VR2 | |
Trachelipodidae | Trachelipus rathkii | France | 2 | G/A | F, R, D | VF1/1737ND |
Trichoniscidae | Trichoniscus pusillus pusillus | France | 1 | G/A | F, R | VF2/VR2 |
Tylidae | Helleria breviconis | France | 2 | G/A | R, D | VF2/VR2 |
Number of individuals tested.
Indicates whether all individuals within species were homoplasmic for guanine (G) or heteroplasmic for guanine and adenine (G/A) at mitochondrial genome position 11973.
Assay used to ascertain 11973 heteroplasmic status: direct sequencing with forward (F) or reverse (R) primer, and HpyCH4V digestion (D).
Primer pairs used to amplify the 11973 mitochondrial genome region by PCR: VF1 (5′-CCCGTTTGAGTGTGGGTTTGA), VF2 (5′- TGGTTTTTGATGTTGAGATT), 2138ND (5′-TCCTAGGGATTGGCCATTTA), VR2 (5′- CGCTTACGTTACGATAAACT) and 1737ND (5′- TATTTGGGTGCGAGGAACTC).