TABLE 1.
Molecular beacon and HP assays used for the first time in this study
| Assay | Purpose | Primer or MBa | Sequenceb |
|---|---|---|---|
| IniA(H481Q) (cat to caG) | MB assay forward primer | FiniA481 | ggccggatggaatcgaaa |
| MB assay reverse primer | RiniA481 | cgccgccataggaaccc | |
| MB complementary to iniA(481H) | MBIniA481T | FAM-TCCGCGcggggccataaaatgat CGCGGA- DABCYL | |
| MB complementary to iniA(481Q) | MBIniA481G | TET-ACCGCCcggggccagaaaatgat GGCGGT- DABCYL | |
| HP assay primer complementary to iniA(481H) | FHPIniA481 | atggccactgccccggggccat | |
| HP assay primer complementary to iniA(481Q) | FHPIniAH481Q | ctggccactgccccggggccag | |
| HP assay shared primer | RIniA481 | cgccgccataggaaccc | |
| GyrA(T95S) (acc to aGc) | HP assay primer complementary to gyrA95 T | RHPGyrA95 | ccctgggccatccgcaccaggg |
| HP assay primer complementary to gyrA95 S | RHPGyrAT95S | gcctgggccatccgcaccaggc | |
| HP assay forward primer | FGyrA95 | cgagaccatgggcaactaccacc |
a
MB, molecular beacon.
b
Capital letters indicate molecular beacon stem sequences; lowercase letters indicate the probe region. FAM, 6-carboxyfluorescein; DABCYL, 4{[4′-(dimethylamino)phenyl]azo}benzoic acid; TET, tetrachloro-6-carboxy fluorescein.