Table 2.
Plasmids used in this study
| Plasmid | Characteristicsa |
|---|---|
| pBTM116-HA | DBDLexA,bTRP1, 2 μm (Imamura et al., 1997). |
| pBTM116-HA-BNI1 (490-1954) | DBDLexA-BNI1 (490-1954), TRP1, 2 μm; made by inserting the 4.4-kb BamHI–SmaI fragment from pACTII-HK-BNI1 (490-1954) (Kohno et al., 1996) into the BamHI–SmaI site of pBTM116-HA. |
| pBTM116-HA-BNI1 (490-1750) | DBDLexA-BNI1 (490-1750), TRP1, 2 μm; made by deleting the 0.6-kb SacII–SmaI fragment from pBTM116-HA-BNI1 (490-1954). |
| pBTM116-HA-BNI1 (490-1415) | DBDLexA-BNI1 (490-1415), TRP1, 2 μm; made by deleting the 1.6-kb PstI–SmaI fragment from pBTM116-HA-BNI1 (490-1954). |
| pBTM116-HA-BNI1 (490-1226) | DBDLexA-BNI1 (490-1226), TRP1, 2 μm; made by inserting the 2.2-kb BamHI–BglII fragment from pACTII-HK-BNI1 (490-1954) (Kohno et al., 1996) into the BamHI site of pBTM116-HA. |
| pBTM116-HA-BNI1 (490-987) | DBDLexA-BNI1 (490-987), TRP1, 2 μm; made by deleting the 2.9-kb SalI–SmaI fragment from pBTM116-HA-BNI1 (490-1954). |
| pBTM116-HA-BNI1 (490-824) | DBDLexA-BNI1 (490-824), TRP1, 2 μm; made by deleting the 3.4-kb XhoI–SmaI fragment from pACTII-HK-BNI1 (490-1954) to generate pACTII-HK-BNI1 (490-824) and subsequently inserting the 1.0-kb BamHI-BglII fragment from pACTII-HK-BNI1 (490-824) into the BamHI site of pBTM116-HA. |
| pBTM116-HA-BNI1 (490-725) | DBDLexA-BNI1 (490-725), TRP1, 2 μm; made by deleting the 3.7-kb BanII–SmaI fragment from pACTII-HK-BNI1 (490-1954) to generate pACTII-HK-BNI1 (490-725) and subsequently inserting the 0.7-kb BamHI–BglII fragment from pACTII-HK-BNI1 (490-725) into the BamHI site of pBTM116-HA. |
| pBTM116-HA-BNI1 (601-987) | DBDLexA-BNI1 (601-987), TRP1, 2 μm; made by inserting the 1.15-kb BamHI-SalI PCR fragment encoding amino acid positions from 601 to 987 of Bni1p into the BamHI-SalI site of pBTM116-HA. The 1.15-kb BNI1 DNA fragment was amplified by PCR using the upstream primer 1,5′-GGCCGGATCCATTGAGTTATATGACAATAATAAACTTG, and the downstream primer 2,5′-GGCCGTCGACATTAAAGTCAATACCAAATCCTTTGTATTTTG. |
| pBTM116-HA-BNI1 (727-987) | DBDLexA-BNI1 (727-987), TRP1, 2 μm; made by inserting the 0.78-kb BamHI–SalI PCR fragment encoding amino acid positions from 727 to 987 of Bni1p into the BamHI–SalI site of pBTM116-HA. The 0.78-kb BNI1 DNA fragment was amplified by PCR using the upstream primer 3,5′-GGCCGGATCCCTAACGAAGAAATTGGAAGAAATTCAGGC, and the downstream primer 2,5′-GGCCGTCGACATTAAAGTCAATACCAAATCCTTTGTATTTTG. |
| pBTM116-HA-BNI1 (826-987) | DBDLexA-BNI1 (826-987), TRP1, 2 μm; made by inserting the 0.49-kb BamHI-SalI PCR fragment encoding amino acid positions from 826 to 987 of Bni1p into the BamHI–SalI site of pBTM116-HA. The 0.49-kb BNI1 DNA fragment was amplified by PCR using the upstream primer 4,5′-GGCCGGATCCAGCCTAAATTCTTCAGAGAAAGCGAATATC, and the downstream primer 2,5′-GGCCGTCGACATTAAAGTCAATACCAAATCCTTTGTATTTTG. |
| pBTM116-HA-SPA2 (1213-1466) | DBDLexA-SPA2 (1213-1466), TRP1, 2 μm; made by inserting the 0.76-kb BamHI-SmaI PCR fragment encoding amino acid positions from 1213 to 1466 of Spa2p into the BamHI-SmaI site of pBTM116-HA. The 0.76-kb SPA2 DNA fragment was amplified by PCR using the upstream primer 5,5′-GGCCGGATCCGAAAATTCACAGGTAAAAAAGACGAGCCACTC, and the downstream primer 6,5′-GGCCCCCGGGTTACTTCAACTTCGAATTCAAATAATTTATTTC. |
| pACT-SPA2 (1213-1466) | ADGAL4,bLEU2, 2 μm; isolated in this study from a yeast cDNA library provided by S. Elledge. |
| pACTII-HK | ADGAL4, LEU2, 2 μm (Ozaki et al., 1996). |
| pACTII-HK-SPA2 (1213-1466) | ADGAL4-SPA2 (1213-1466), LEU2, 2 μm; made by inserting the 0.76-kb BamHI–SmaI fragment from pBTM116-HA-SPA2 (1213-1466) into the BamHI–SmaI site of pACTII-HK. |
| pACTII-HK-BNI1 (1-1954) | ADGAL4-BNI1 (1-1954), LEU2, 2 μm (Kohno et al., 1996). |
| pACTII-HK-BNI1 (1-1750) | ADGAL4-BNI1 (1-1750), LEU2, 2 μm; made by deleting the 0.6-kb SacII–SmaI fragment from pACTII-HK-BNI1 (1-1954). |
| pACTII-HK-BNI1 (1-1327) | ADGAL4-BNI1 (1-1327), LEU2, 2 μm; made by deleting the 1.9-kb NaeI–SmaI fragment from pACTII-HK-BNI1 (1-1954). |
| pACTII-HK-BNI1 (1-824) | ADGAL4-BNI1 (1-824), LEU2, 2 μm; made by deleting the 3.4-kb XhoI–SmaI fragment from pACTII-HK-BNI1 (1-1954). |
| pACTII-HK-BNI1 (1-725) | ADGAL4-BNI1 (1-725), LEU2, 2 μm; made by deleting the 3.7-kb BanII–SmaI fragment from pACTII-HK-BNI1 (1-1954). |
| pUC18-SPA2-1 | SPA2; made by inserting the 4.4-kb PCR fragment of SPA2 open reading frame into the BamHI–HincII site of pUC18. The 4.4-kb SPA2 DNA fragment was amplified by PCR using the upstream primer 7,5′-GGCCGGATCCATGGGTACGTCAAGCGAGGTTTCTCTCGCAC, and the downstream primer 6,5′-GGCCCCCGGGTTACTTCAACTTCGAATTCAAATAATTTATTTC. |
| pUC18-SPA2-2 | SPA2; made by inserting the 5.7-kb fragment of SPA2, including the 0.57-kb upstream and 0.77-kb downstream noncoding regions of SPA2, into the SalI-BamHI site of pUC18. The 5.7-kb SPA2 DNA fragment was amplified by PCR using the upstream primer 8,5′-GGCCG TCGACGACACTGCTATATCCTTCGACTACGTAACC, and the downstream primer 9,5′-GGCCGGATCCTCGACAGAAAAACTTTAAGCTTACAATGGC. |
| pUC19-BNI1 | BNI1; made by inserting the 6.5-kb BamHI-SmaI BNI1 fragment from pBS-BNI1 (Kohno et al., 1996) into the BamHI-SmaI site of pUC19. |
| pUC18-spa2::HIS3 | spa2::HIS3, a derivative of pUC18-SPA2-1; made by replacing the 2.0-kb MunI-HincII internal fragment of SPA2, corresponding to amino acid positions from 352 to 1033 of Spa2p, with the 1.8-kb HIS3 fragment. |
| pUC18-spa2::URA3 | spa2::URA3, a derivative of pUC18-SPA2-2; made by replacing the 4.4-kb EcoRV-XbaI internal fragment of SPA2 corresponding to amino acid positions from 15 to 1466 of Spa2p with the 1.2-kb URA3 fragment. |
| pBS-bni1::HIS3 | bnil1::HIS3-1 (Kohno et al., 1996). |
| pUC19-bni1::HIS3-2 | bni1::HIS3-2, a derivative of pUC19-BNI1; made by replacing the 3.1-kb MunI–BsaAI internal fragment of BNI1 corresponding to amino acid positions from 678 to 1715 of Bni1p with the 1.8-kb HIS3 fragment. |
| pRS314 | TRP1, CEN6 (Sikorski and Hieter, 1989). |
| pRS314-GAL1 | TRP1, CEN6; made by inserting the 0.74-kb ScaI–HindIII fragment, containing the GAL1 promoter, a multicloning site, and the TDH1 terminator, into the SpeI (filled-in)–HindIII site of pRS314. |
| pRS314-GAL1-myc | TRP1, CEN6; made by inserting the synthetic oligonucleotide encoding three copies of the myc epitope, EQKLISEEDL, which is derived from the human c-myc protein, into the EcoRI–PstI site in the multicloning site of pRS314-GAL1. |
| pRS314-GAL1-myc-BNI1 | TRP1, CEN6, GAL1-myc-BNI1; made by inserting the 5.9-kb BamHI–SmaI fragment from pACTII-HK-BNI1 (1-1954) containing the BNI1 open reading frame (Kohno et al., 1996) into the BamHI–SmaI site of the multicloning site of pRS314-GAL1-myc, to place BNI1 downstream of the three myc epitopes. |
| pRS314-GAL1-myc-BNI1 (490-1954) | TRP1, CEN6, GAL1-myc-BNI1 (490-1954); made by inserting the 4.4-kb BamHI-SmaI fragment from pACTII-HK-BNI1 (490-1954) (Kohno et al., 1996) into the BamHI-SmaI site of pRS314-GAL1-myc. |
| pMAL-c2-SPA2 (1213-1466) | MBP-SPA2 (1213-1466); made by inserting the 0.76-kb BamHI–BglII DNA fragment of SPA2 from pACTII-HK-SPA2 (1213-1466) into the BamHI site of pMAL-c2 (New England BioLabs). |
| pGEX-4T-2-HA | GST-HA (Imamura et al., 1997). |
| pGEX-4T-2-HA-BNI1 (826-987) | GST-HA-BNI1 (826-987); made by inserting the 0.49-kb BamHI-SalI DNA fragment of BNI1 from pBTM116-HA-BNI1 (826-987) into the BamHI–SalI site of pGEX-4T-2-HA. |
a
Underlined sequences are portions of the BNI1 or SPA2 gene.
b
DBDLexA and ADGAL4 are the DNA-binding domain of LexA and the transcriptional activation domain of GAL4, respectively.