Skip to main content
. 2003 Oct;41(10):4521–4524. doi: 10.1128/JCM.41.10.4521-4524.2003

TABLE 1.

RT-PCR protocols for rapid diagnosis of CoV associated with SARSa

Characteristic or component of protocol WHO-HKU
WHO-Hamburg
RT PCR RT-PCR Second PCR
Primer sequences
    Sense TACACACCTCAGCGTTG ATGAATTACCAAGTCAATGGTTAC GAAGCTATTCGTCACGTTCG
    Antisense CACGAACGTGACGAAT CATAACCAGTCGGTACAGCTAC CTGTAGAAAATCCTAGCTGGAG
Reagent formulation Superscript II RTA (Invitrogen) AmpliTaq Gold (Roche) Superscript II RT-PCR (Invitrogen) AmpliTaq Gold (Roche)
    (i) 4 μl of 5× first-strand buffer     (i) 5 μl of 10× reaction buffer     (i) 10 μl of 2× reaction buffer     (i) 5 μl of 10× reaction buffer
    (ii) 10 mM DTT     (ii) 200 μM dNTP     (ii) 2.45 mM MgSO4     (ii) 200 μM dNTP
    (iii) 500 μM dNTP     (iii) 2.5 mM MgSO4     (iii) 500 nM (each) primer     (iii) 2.5 mM MgSO4
    (iv) 0.15 μg of random primer     (iv) 250 nM (each) primer     (iv) 0.4 μl of RTA-Taq mixture     (iv) 200 nM (each) primer
    (v) 200 U of Superscript II     (v) 2 U of AmpliTaq Gold     (v) 2 μl of RNA extract     (v) 2 U of AmpliTaq Gold
    (vi) 12 μl of RNA extract     (vi) 2 μl of RT product     (vi) Make up to total volume of 20 μl     (vi) 1 μl of RT-PCR product
    (vii) Make up to total volume of 20 μl     (vii) Make up to total volume of 50 μl     (vii) Make up to total volume of 50 μl
Thermal cycling profile (i) 25°C, 10 min (i) 94°C, 10 min (i) 45°C, 30 min (i) 95°C, 5 min
(ii) 42°C, 50 min (ii) 40 cycles (ii) 95°C, 3 min (ii) 10 cycles
(iii) 94°C, 3 min     (a) 94°C, 30 s (iii) 10 cycles     (a) 95°C, 10 s
    (b) 50°C, 40 s     (a) 95°C, 10 s     (b) 60°C, 10 s (decrease by 1°C/cycle)
    (c) 72°C, 15 s     (b) 60°C, 10 s (decrease by 1°C/cycle)     (c) 72°C, 20 s
(iii) 72°C, 10 min     (c) 72°C, 30 s (iii) 20 cycles
(iv) 40 cycles     (a) 95°C, 10 s
    (a) 95°C, 10 s     (b) 56°C, 10 s
    (b) 56°C, 10 s     (c) 72°C, 20 s
    (c) 72°C, 30 s
Expected PCR product size (bp) 182 189 108
a

The RT-PCR protocols of two WHO SARS network laboratories, WHO-HKU (8) and WHO-Hamburg (4), are also available online (http://www.who.int/esr/sars/primers/en. Abbreviations: RTA, reverse transcriptase; DTT, dithiothreitol; dNTP, deoxynucleoside triphasphate.