TABLE 1.
Characteristic or component of protocol | WHO-HKU
|
WHO-Hamburg
|
|||
---|---|---|---|---|---|
RT | PCR | RT-PCR | Second PCR | ||
Primer sequences | |||||
Sense | TACACACCTCAGCGTTG | ATGAATTACCAAGTCAATGGTTAC | GAAGCTATTCGTCACGTTCG | ||
Antisense | CACGAACGTGACGAAT | CATAACCAGTCGGTACAGCTAC | CTGTAGAAAATCCTAGCTGGAG | ||
Reagent formulation | Superscript II RTA (Invitrogen) | AmpliTaq Gold (Roche) | Superscript II RT-PCR (Invitrogen) | AmpliTaq Gold (Roche) | |
(i) 4 μl of 5× first-strand buffer | (i) 5 μl of 10× reaction buffer | (i) 10 μl of 2× reaction buffer | (i) 5 μl of 10× reaction buffer | ||
(ii) 10 mM DTT | (ii) 200 μM dNTP | (ii) 2.45 mM MgSO4 | (ii) 200 μM dNTP | ||
(iii) 500 μM dNTP | (iii) 2.5 mM MgSO4 | (iii) 500 nM (each) primer | (iii) 2.5 mM MgSO4 | ||
(iv) 0.15 μg of random primer | (iv) 250 nM (each) primer | (iv) 0.4 μl of RTA-Taq mixture | (iv) 200 nM (each) primer | ||
(v) 200 U of Superscript II | (v) 2 U of AmpliTaq Gold | (v) 2 μl of RNA extract | (v) 2 U of AmpliTaq Gold | ||
(vi) 12 μl of RNA extract | (vi) 2 μl of RT product | (vi) Make up to total volume of 20 μl | (vi) 1 μl of RT-PCR product | ||
(vii) Make up to total volume of 20 μl | (vii) Make up to total volume of 50 μl | (vii) Make up to total volume of 50 μl | |||
Thermal cycling profile | (i) 25°C, 10 min | (i) 94°C, 10 min | (i) 45°C, 30 min | (i) 95°C, 5 min | |
(ii) 42°C, 50 min | (ii) 40 cycles | (ii) 95°C, 3 min | (ii) 10 cycles | ||
(iii) 94°C, 3 min | (a) 94°C, 30 s | (iii) 10 cycles | (a) 95°C, 10 s | ||
(b) 50°C, 40 s | (a) 95°C, 10 s | (b) 60°C, 10 s (decrease by 1°C/cycle) | |||
(c) 72°C, 15 s | (b) 60°C, 10 s (decrease by 1°C/cycle) | (c) 72°C, 20 s | |||
(iii) 72°C, 10 min | (c) 72°C, 30 s | (iii) 20 cycles | |||
(iv) 40 cycles | (a) 95°C, 10 s | ||||
(a) 95°C, 10 s | (b) 56°C, 10 s | ||||
(b) 56°C, 10 s | (c) 72°C, 20 s | ||||
(c) 72°C, 30 s | |||||
Expected PCR product size (bp) | 182 | 189 | 108 |
The RT-PCR protocols of two WHO SARS network laboratories, WHO-HKU (8) and WHO-Hamburg (4), are also available online (http://www.who.int/esr/sars/primers/en. Abbreviations: RTA, reverse transcriptase; DTT, dithiothreitol; dNTP, deoxynucleoside triphasphate.