G2 accumulation by Vif is dependent on residues required for interaction with Cul5 and Elongin B/C. (A) Defective vectors with the indicated point mutations were used to infect SupT1 cells, and, 48 h later, cells were analyzed for cell cycle profile. (B) Expression levels for Vif were confirmed by Western blotting. (C) HeLa cells were transfected with nonspecific or Cul5-specific siRNA, using Oligofectamine (Invitrogen, Carlsbad, CA). The target sequence for Cul5 siRNA was CAGCTGGTTATTGGAGTAAGA (Qiagen). Cell extracts from the siRNA transfections were assayed for Cul5, using Western blotting. (D) At 24 h after siRNA transfection, cells were infected with the indicated viruses.