Table 1.
Potential SOS boxes of genes that bind or do not bind LexA repressor.
| Gene | SOS box sequence | HI* | NM** |
|---|---|---|---|
| Consensus | TACTGTATATATATACAGTA | 0 | |
| A. Genes whose SOS boxes bind LexA and are regulated by LexA represor | |||
| recA | TACTGTATGAGCATACAGTA | 4.31 | 1 |
| umuDC | TACTGTATATAAAAACAGTA | 2.77 | 2 |
| uvrB | AACTGTTTTTTTATCCAGTA | 6.11 | 5 |
| polB | GACTGTATAAAACCACAGCC | 12.09 | 5 |
| lexA1 | TGCTGTATATACTCACAGCA | 6.34 | 4 |
| lexA2 | AACTGTATATACACCCAGGG | 8.32 | 6 |
| B. Genes whose potential SOS boxes do not bind LexA but re not LexA regulated | |||
| intE | GGCTGCTGAAAAATACAGAA | 16.04 | 7 |
| ymfI | TTCTGTACCAGAAAACAGTT | 15.48 | 8 |
| ymfM | AGCTGCAGGAGCATGCAGCA | 19.32 | 3 |
| lit | TGATGACAGAGTGTCCAGTG | 20.32 | 8 |
| C. Genes whose SOS boxes do not bind LexA in spate of low HI value | |||
| yigN | AACTGGACGTTTGTACAGCA | 9.27 | 5 |
| dinJ | AGCTGAATAAATATACAGCA | 7.06 | 3 |
Potential SOS boxes (sequence on coding strand) that bind (A), or do not bind (B and C) LexA repressor.
HI* denotes heterology index; NM** denotes the number of mismatches in SOS boxes deviating from a perfect palindrome. The lack of LexA repressor binding despite a relatively low HI value (section C) testifies that there is no direct correlation between them 28. Anyhow, it indicates that the HI value cannot be the only indicator of the ability of an SOS box to bind LexA. The number of mismatches in the palindromic SOS boxes in each of the sections is similar, and does therefore not determine LexA binding ability with the SOS boxes. Data in parts A and C are from ref. 28, those in part B are from ref. 31.