Fig. 2.
2,700-fold alteration of substrate specificity by W123Q alteration. The chicken Hint cDNA was amplified from EST clone pat.pk0069.a10 from the University of Delaware using primers 7038 (5′ GATCGTCCATATGGCTGACGAGATCCGCAAGG) and 7039 (5′ CACTCTCGAGTTAGCCAGGAGGCCAGCCCAACTG) and cloned into pSGA02 as an NdeI-XhoI fragment. The W123Q substitution was introduced (9) with mutagenic primer 7046 (5′ GGTCGTCAGTTGGGCCAGCCTCCTGGCTAA). Enzymes were purified as described (2, 8). tBoc-LysAMP-MCA assays, at 5 - 50 μM, described and validated in detail in Supplementary Materials, were performed with 1.8 fmol of wild-type or 19 fmol Hint-W123Q at pH 5.5 with 1 mM EDTA. Reactions (10-20 min) were stopped by adjusting the pH to 9.5, addition of trypsin to a final concentration of 60 μg/μl to liberate AMC, and quantitated by fluorescence. AMP-pNA assays with 3.6 pmol wild-type or 0.36 pmol Hint-W123Q were as described (8). Filled symbols are on the left Y-axis. Open symbols are on the right Y-axis.