Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 May 10.
Published in final edited form as: Virology. 2008 Feb 1;374(2):292–303. doi: 10.1016/j.virol.2007.12.016

Effects of Cellular Differentiation, Chromosomal Integration and 5’-Aza-2’-Deoxycytidine Treatment on Human Papillomavirus-16 DNA Methylation in Cultured Cell Lines

Mina Kalantari 1, Denis Lee 2, Itzel E Calleja-Macias 1, Paul F Lambert 2,3, Hans-Ulrich Bernard 1,3
PMCID: PMC2556224  NIHMSID: NIHMS50216  PMID: 18242658

Abstract

Human papillomavirus-16 (HPV-16) genomes in cell culture and in situ are affected by polymorphic methylation patterns, which can repress the viral transcription. In order to understand some of the underlying mechanisms, we investigated changes of the methylation of HPV-16 DNA in cell cultures in response to cellular differentiation, to recombination with cellular DNA, and to an inhibitor of methylation. Undifferentiated W12E cells, derived from a precancerous lesion, contained extrachromosomal HPV-16 DNA with a sporadically methylated enhancer-promoter segment. Upon W12E cell differentiation, the viral DNA was demethylated, suggesting a link between differentiation and the epigenetic state of HPV-16 DNA. The viral genomes present in two W12I clones, in which individual copies of the HPV-16 genome have integrated into cellular DNA (type 1 integrants), were unmethylated, akin to that seen in the cervical carcinoma cell line SiHa (also a type 1 integrant). This finding is consistent with hypomethylation being necessary for continued viral gene expression. In contrast, two of three type 2 integrant W12I clones, containing concatemers of HPV-16 genomes integrated into the cellular DNA contained hypermethylated viral DNA, as observed in the cervical carcinoma cell line CaSki (also a type 2 integrant). A third, type 2, W12I clone, interestingly with fewer copies of the viral genome, contained unmethylated HPV-16 genomes. Epithelial differentiation of W12I clones did not lead to demethylation of chromosomally integrated viral genomes as was seen for extrachromosmal HPV- 16 DNA in W12E clones. Hypomethylation of CaSki cells in the presence of the DNA methylation inhibitor 5-aza-2’-deoxycytidine reduced the cellular viability, possibly as a consequence of toxic effects of an excess of HPV-16 gene products. Our data support a model wherein (i) the DNA methylation state of extrachromosomal HPV16 replicons and epithelial differentiation are inversely coupled during the viral life cycle, (ii) integration of the viral genome into the host chromosome events leads to an alteration in methylation patterns on the viral genome that is dependent upon the type of integration event and possibly copy number, and (iii) integration universally results in the viral DNA becoming refractory to changes in methylation state upon cellular differentiation that are observed with extrachromosomal HPV-16 genomes.

INTRODUCTION

Most cis-responsive elements that modulate the transcription from the E6 promoter of the human papillomaviruses (HPVs) that are involved in cervical carcinogenesis are condensed in a relatively small genomic segment (about 400 bp) in the 3’ half of the long control region (LCR). This segment contains binding sites for numerous cellular and viral transcriptional activators and repressors and for the factors that initiate replication (reviewed in Bernard, 2002). Transcriptional regulation of these HPVs is very complex due to the synergies and antagonism between these elements, and is further complicated since the availability of the transcription factors varies in different epithelia and different layers of an epithelium and during different stages of carcinogenesis. Beyond the effects of sequence specific factors, gene regulation is strongly influenced by the chromatin organization of HPV genomes (Stünkel and Bernard, 1999; Zhao et al., 1999; DelMar Pena and Laimins, 2001). Just like the chromosomal DNA of all eukaryotes, HPV DNA is organized in form of nucleosomes, which can undergo conformational changes under the influence of histone acetylation, histone deacetylation, DNA methylation, and (not yet shown for HPVs) histone methylation (Stünkel and Bernard, 1999; Zhao et al., 1999; Badal et al., 2003; Kim et al., 2003; van Tine et al., 2004; Kalantari et al., 2004; Wiley et al., 2005; Balderas-Loaeza et al., 2007). Chromatin changes can induce or repress transcription (Bird, 2002; Fuks, 2005; Goll and Bestor, 2005) as a consequence of a complex regulatory network sometimes referred to as “epigenetic conversation”. DNA methylation refers to the transfer of a methyl group to a cytosine residue, which is most often part of a CpG dinucleotide. Methylated CpGs (meCpGs) of cellular DNA and likely also of HPVs are recognized by methylated DNA binding factors such as MeCP2 (Klose et al., 2005), which affect surrounding chromatin due to their association with histone deacetylases (HDACs). As a consequence, methylated DNA sequences are normally in a transcriptionally repressed state.

It has been shown that completely methylated HPV-16 DNA is transcriptionally inactive (Rösl et al., 1993). Investigation of viral genomes in situ and in cell culture showed that the CpGs of the LCR of HPV-16 are very often methylated, but normally in scattered patterns rather than completely. The average of multiple clinical samples and multiple molecules from each sample derived from carcinomas, precancerous lesions, asymptomatic infections, and cancer and precancerous cell lines showed methylation rates of individual CpGs between three and about twenty percent (Badal et al., 2003; Kim et al., 2003; Kalantari et al., 2004). The consequences of these methylation patterns have not yet been measured. However, one can infer that a single meCpG dinucleotide may bind methylated DNA binding proteins and therefore likely affects at least one if not both flanking nucleosomes. Consequently, one or few meCpGs in the LCR of HPV-16 can suffice to target the two nucleosomes that are specifically positioned on the viral enhancer and promoter (Stünkel and Bernard, 1999), thereby repressing early transcription. In relation to the data that we report in this study we therefore posit that a single meCpG within or close to the HPV-16 enhancer or promoter segments is sufficient to cause an impairment of early transcription.

The presently available knowledge about HPV-16 genome methylation was garnered from cellular material sampled at static conditions, namely from the cell lines W12 (Kim et al., 2003), CaSki and SiHa (Badal et al., 2003; Kalantari et al., 2004) or from cervical, anal and oral samples (Kalantari et al., 2004; Wiley et al., 2005; Balderas-Loaeza et al., 2007). We do not yet have information about the change of methylation in response to growth conditions in cell culture or changing physiological or pathological conditions in individual patients over time. The experiments that led to this publication aimed to understand how HPV-16 DNA methylation is affected in cell culture by epithelial differentiation, chromosomal recombination, and inhibition of methylation in order to hypothesize and eventually measure how these events would affect the virus in situ.

RESULTS

Concept of this study

The LCR of HPV-16 is an 850 bp DNA segment between the genomic nucleotide positions 7154 and 97 flanked on the 5’ end by the L1 gene and on the 3’ end by the E6 gene. It contains a transcriptional enhancer with numerous cis-responsive elements between the positions 7500 and 7820, a replication origin with E1 and E2 binding sites between the nucleotide positions 7860 and 10, a silencer with CDP and YY1 binding sites overlapping with the replication origin, and a promoter region with four elements between the nucleotide positions (nts) 27 and 70 (reviewed in Bernard, 2002). Five CpGs overlap with the enhancer (@ nts 7535, 7554, 7677, 7683, 7689), of which one (@ nts 7862) is part of an E2 binding site that activates the replication origin, and five others (@ nts 31, 37, 43. 52, 58) overlap with the promoter, the first one being within the Sp1 site and the other four positioned within two E2 binding sites (Tan et al., 1994; Demeret et al., 1997). It is likely that methylation of a single one of these eleven CpG sites negatively affects transcription from the E6 promoter due to predicted effects of methylation on the two nucleosomes that are specifically positioned over the enhancer and promoter. The functional consequences of methylation of eight CpGs overlapping with L1 (@ nts 7091, 7136, 7145) and of the 5’ part of the LCR (at nts 7270, 7428, 7434, 7455, 7461) are unknown. Interestingly, nucleotide positions 7455 and 7461 are part of an E2 binding site, whose function is not well understood. Fig. 1 shows landmarks of the HPV-16 LCR and the position of all 19 CpGs that we investigated.

Fig. 1. CpGs in the Long control region and 3’ end of the L1 gene in HPV-16.

Fig. 1

Open in a new tab

The upper part of the figure summarizes the functional and topologic elements of this genomic segment, the lower part the relative position of the 19 CpG residues addressed by our study.

Cell lines or clinical samples often contain numerous HPV genomes. Because we learned in our previous research that each of these genomes may be affected differently by DNA methylation, we standardized our analyses by cloning and sequencing ten to 16 HPV-16 amplimer molecules after bisulfite modification, PCR amplification, and cloning into E. coli vectors. We report the data from these experiments graphically as introduced previously (Kalantari et al., 2004) and presented in the figures of this paper. Vertically arranged rectangles refer to the CpGs in a specific genomic position and horizontally arranged rectangles to the CpGs in different amplicons. White rectangles identify unmethylated and black rectangles methylated CpGs. Since the whole region of interest within the HPV16 genome cannot be amplified in form of a single amplicon due to covalent cleavage of DNA by bisulfite, each horizontal line of rectangles represents three independent amplicons, which had originally not been contiguous.

Methylation of episomal HPV-16 DNA in W12 cell cultures

W12 cells were derived from a precancerous lesion (Stanley et al., 1989) and contain about 1000 extrachromosomal HPV-16 genomes, as measured in two subclones (20850 and 20863) established previously (Jeon et al., 1995; Jeon and Lambert, 1995). Fig. 2A shows that six out of 16 clones of HPV-16 clones from 20850 and eight out of 16 clones from 20863 contained one or two meCpGs, respectively, overlapping with the viral enhancer or promoter (average methylation rate for each CpG 4.0 and 7.4%, respectively). This is a very low rate of methylation, but it nevertheless suggests that a third to a half all HPV-16 genomes in W12 cells may be partially or completely transcriptionally repressed due to epigenetic effects. Methylation was much higher in the L1 segment and the 5’ LCR, with 17 and 58 meCpGs, respectively, out of 128 potential CpG targets (13.3 and 45.3%). The reason for this difference is not known, as prior analyses did not detect important biological differences between these two clones, and may not be of consequence since this region of the viral genome is not expressed until differentiation occurs (see below).

Fig. 2. Methylation of a genomic segment of HPV-16 including the whole long control region (LCR) and a segment of the L1 gene in undifferentiated and differentiated W12 cells with episomal viral copies.

Fig. 2

Open in a new tab

A: W12 clone 20850; B: W12 clone 20863. Each vertical set of rectangles represents one of 19 specific CpG dinucleotides, the number on the top of the bar the position of this CpG in the genome of HPV-16. Each horizontal set of rectangles represents a 913 bp segment of the HPV-16 genome, covering the 3’ end of the L1 gene and the complete long control region. Unmethylated CpGs are indicated by white rectangles, methylated by black ones. The two vertical white separators indicate the borders between amplicons, and discontinuities between supposedly different HPV-16 molecules. The numbers on the left side of the figure identify the W12 subclone. Diff: differentiated cells, undiff: undifferentiated cells.

Demethylation of episomal HPV-16 DNA in W12 cells in response to differentiation

Prior studies had demonstrated that treatment of W12E cells with high concentrations of calcium ions and serum at confluent growth results in their terminal differentiation, as judged by the induction of Keratin 10 expression, and the formation of stratified epithelium with the appearance of keratin bundles, nuclear condensation and virus like particles in the more superficial layers (Flores et al., 1997). We confirmed that we could recapitulate this induction of differentiation of W12E cells using the same culture conditions by monitoring for the expression of differentiation markers (Fig. 3). Fig. 2B shows that the HPV-16 genomes in the clones 20850 and 20863 lost all cytosine methylation in the enhancer and promoter segment in response to this differentiation protocol. Only four meCpGs were maintained in the L1/5’LCR segment of clone 20850. This finding of hypomethylation in HPV-16 replicons in differentiated W12E cells is consistent with our prior data analyzing differentiated subfractions of W12E cells isolated by elutriation (Kim et al., 2003). That the L1 region becomes unmethylated might be of importance since this L1, which encodes the major capsid protein, is induced in its expression during terminal differentiation allowing for the production of progeny virions.

Fig. 3. Induction of epithelial differentiation.

Fig. 3

Open in a new tab

Shown are Western blots demonstrating the induction of the expression of involucrin, a marker for epithelial cell differentiation of stratified squamous epithelia, in those cells grown in high calcium/high serum. Also shown are control, beta-actin-specific Western blots demonstrating that equal amounts of total cellular protein were loaded. Note induction in the levels of involucrin in cells cultured in the presence of high calcium and high serum.

Demethylation of HPV-16 DNA in W12 clones in response to chromosomal integration of individual viral genomes

The clones 20822 and 201402 were derived from W12 cells during culture in vitro. They have lost all extrachromosomal HPV-16 DNA replicons, but maintained three and five HPV-16 genomes, respectively, that have recombined with cellular DNA as single genomic copies that had then subsequently underwent amplification along with neighboring DNA (i.e. type 1 integrated clones) (Jeon et al., 1995; Jeon and Lambert, 1995). Fig. 4 shows that these integrated viral DNA genomes are unmethylated in both cell clones within the enhancer and promoter segments, as 16 and ten E. coli clones, respectively, did not contain a single meCpG dinucleotide. A rudimentary level of methylation is maintained in the L1-5’LCR region (7 and 5%, respectively). This outcome resembles the methylation state of HPV-16 in the carcinoma derived SiHa cells, also containing a type 1 integration event, whose LCR is unmethylated, while L1 is hypermethylated (Badal et al., 2003; Kalantari et al., 2004).

Fig. 4. Methylation of a genomic segment of HPV-16 including the LCR and a segment of the L1 gene in undifferentiated and differentiated W12 clones with chromosomally integrated HPV-16 genomes.

Fig. 4

Open in a new tab

A: individual HPV-16 genomes integrated into the chromosomal DNA (type 1 integrants); B: concatemeric HPV-16 genomes integrated into the chromosomal DNA (type 2 integrants). The notation system of the data is explained in detail in the legend to Fig. 1.

Multiple, tandemly integrated HPV-16 genomes became hypermethylated in two and unmethylated in one W12 derivative

In contrast to the two W12 type 1 integrant clones, the clones 20831, 20862, and 20861 contain numerous integrated HPV-16 genomes, all or the majority of which are arranged as tandem or concatemeric repeats (type 2 integration). Quantitative Southern blots led to estimates of 60, 60, and 30 HPV-16 DNA copies in these three clones, respectively (Jeon et al., 1995; Jeon and Lambert, 1995). Fig. 4 shows that the viral DNA genomes present in clones 20831 and 20862 were hypermethylated in the enhancer-promoter segment (42 [23.9%] and 62 [35.2%] meCpGs, respectively, of 176 potential CpG targets) as well as in the L1-5’LCR segment (39 [30.5%] and 38 [29.7%] meCpGs among 128 potential CpG targets). This outcome resembles the situation observed in many cervical cancers and in the cervical carcinoma derived CaSki cell line that harbors type 2 integrated HPV DNAs, in which most of the 500 concatemeric HPV-16 genomes are hypermethylated in the LCR and L1. In contrast, in clone 20861 only a single one of 16 HPV-16 copies contained three meCpGs, and five of 16 clones contained single meCpGs in the L1 gene. The rest of the DNA analyzed from clone 20861 was hypomethylated. A similar outcome had been observed in the analysis of a small fraction of cancer samples that we studied (Badal et al., 2003; Kalantari et al., 2004). Interestingly, clone 20861 containing mostly unmethylated HPV-16 genomes expresses the viral E6 and E7 oncoproteins and E6/E7 mRNAs at the highest levels even though, among the type 2 integrants, it has the fewest copies of the viral genome (Jeon et al., 1995; Jeon and Lambert, 1995; Shai et al., 2007).

Methylation of integrated HPV-16 genomes does not change in response to differentiation

We observed that extrachromosomal HPV-16 genomes become hypomethylated in differentiated W12E cells (Fig. 2B; also see Kim et al., 2003). To address the question whether cellular differentiation also influences the methylation status of integrated HPV-16 genomes, we exposed all five W12I clones to differentiation promoting culture conditions. All W12I clones underwent differentiation as judged by the induction in expression of differentiation markers (Figure 3). This is consistent with our prior findings that W12I clones are susceptible to differentiation, to a degree similar to that of W12E clones (Jeon et al., 1995). The two type 1 integrant W12I clones with hypomethylated sequences (20822, 201402) remained unmethylated in the LCR and hypomethylated in L1 (Fig. 4), similar to the type 2 integrant 20861, which remained hypomethylated in the LCR, and even showed a slight increase of methylation in L1. More interestingly, the hypermethylated state of the viral DNA observed in the W12I clones 20862 and 20831 was not reduced upon their growth in differentiating culture conditions (i.e. methylation throughout the 19 CpG studied here), as the methylation rate was 32.9% in 20862 and 26.6% in 20831 before differentiation, and 35.8% and 38.4%, respectively, afterwards.

We measured the levels of E6/E7 transcripts during the course of all differentiation experiments by real-time PCR. Surprisingly, we observed a slight decrease of transcription, which was, however, also reflected in the decreased transcription of a cellular control gene (Fig. 5). This was observed for multiple clones of W12 cells including the W12E clone 20850 wherein the viral DNA becomes hypomethylated upon differentiation. The fact that the transcripts are less abundant in the terminally differentiated W12E cells is consistent with previously published studies on E7 by Western blotting in raft cultures of cells harboring extrachromsomal DNA (Collins et al., 2005). This does not provide evidence against derepression of HPV transcription by demethylation, but more likely points to a general reduction of transcriptional activity during epithelial differentiation and/or the sequestration of amplified viral DNA in capsids in the terminally differentiated cells.

Fig. 5. Transcription of HPV-16 E6 and E7 and, as control, the cellular ribosomal protein S9 as measured by RT PCR.

Fig. 5

Open in a new tab

Left columns of each pair: undifferentiated cells; right column: differentiated cells. The data suggest a general reduction of transcriptional activity in response to epithelial differentiation and do not allow to measure the expected transcriptional induction of clone 20850 due to demethylation.

5-aza-2’-deoxycytidine reduces the methylation of HPV-16 genomes and the viability of the tumor cell line CaSki

The phenotypic consequences of HPV-16 DNA methylation and demethylation during the productive viral life cycle and during carcinogenesis are not yet known. To begin to understand the consequences of demethylation of HPV-16 genomes in a tumor cell line, we investigated the response of CaSki cells to treatment with the DNA methylation inhibitor 5’-aza-2’-deoxycytidine (5-Aza-CdR). CaSki cells contain about 500 HPV-16 genomes, which are hypermethylated (Kalantari et al., 2004) with the consequence that all of these viral genomes except one copy are transcriptionally silent (van Tine et al., 2004).

As a baseline, we confirmed previous data that the LCR and L1 of most HPV-16 copies in CaSki is hypermethylated, with 108 meCpGs out of a total of 152 target CpGs (71.1%). Growth of the cells in the presence of 5 µM 5-Aza-CdR for 72 hours reduced methylation in these segments to 27.6% (42 out of 152) (Fig. 6). Some of the enhancer and promoter clones from the 5-Aza-CdR-treated CaSki cells were completely demethylated, although a demethylation of contiguous enhancer-promoter segments cannot be confirmed as the enhancer and promoter clones were derived from random different HPV-16 template DNAs present in the extracted DNA from CaSki cells.

Fig. 6. Methylation changes of a genomic segment of HPV-16 including the LCR and a segment of the L1 gene in CaSki cells in response to treatment with 5’-deoxy-2’azacytidine.

Fig. 6

Open in a new tab

The notation system of the data is explained in detail in the legend to Fig. 1.

We measured the levels of E6/E7 transcripts during the course of these experiments by real-time PCR, but did not detect obvious changes (data not shown). This does not provide evidence against release of repression by demethylation, as the increased activity of some few demethylated HPV-16 genomes on a background of an excess of continuously repressed methylated genomes may not lead to a measurable difference in signal.

Growth of CaSki cells under the influence of 5-Aza-CdR slowed down after five days and completely stopped in the second week of treatment, combined with physical changes of the cells (flat growth, development of cytoplasmic extensions, high transparency), indicating stress or death of these cells. This may relate to the derepression of HPV-16, since the growth and physical properties of SiHa cells, which have a single unmethylated HPV-16 genome (Kalantari et al., 2004) and HeLa cells, which have about 50, mostly 11 unmethylated HPV-18 genomes (Turan et al., 2006 and 2007) were not affected in their growth or physical properties by treatment with 5-Aza-CdR (data not shown).

DISCUSSION

Extrachromosomal HPV-16 genomes are subject to differentiation specific methylation and demethylation

We report that extrachromosomal HPV-16 DNA in the W12 clones 20850 and 20863 is targeted by scattered and quantitatively moderate DNA methylation as long as these cells are cultured such that they resemble the undifferentiated basal epithelial layer. In response to differentiation, methylation is lost. These observations support previous data from the lab of one of us that elutriation of W12 cultures separates small, undifferentiated cells, which have mostly methylated HPV-16 genomes, from large, differentiated cells with mostly unmethylated viral DNA (Kim et al., 2003). These cell culture data may also explain correlations observed in the study of clinical samples. Methylation of HPV-16 in asymptomatic infections was found to exceed the methylation of HPV-16 in precancerous lesions, most likely since asymptomatic infections contain many HPV-16 genomes in undifferentiated cells, possibly in a state of latency, while most HPV-16 genomes in lesions may exist in suprabasal cells (Kalantari et al., 2004). The underlying mechanism for differentiation linked methylation and demethylation is presently not known. One possibility is that the sequence specific factors CDP and YY1, which bind HPV silencers (O’Connor et al., 1997 and 2000) specifically in undifferentiated cells (Pattison et al., 1997; Ai et al., 2000) may trigger a cascade of histone methylation (Rezai-Zadeh et al., 2003; Nishio et al., 2004) and de novo DNA methylation (Fuks, 2005). The high concentration of CDP and YY1 in undifferentiated cells and the binding of these factors to HPV-16 genomes may therefore be the primary trigger to induce methylation, and loss of these two factors may result in demethylation during subsequent rounds of replication in differentiating cells. This proposed mechanism would add another pathway to explain how epithelial differentiation and transcription of HPVs are linked beyond the previously discovered coupling of AP-1, CDP and YY1 with histone acetylases and deacetylases (reviewed in Bernard, 2002). Alternatively, one can propose that as extrachromosomal viral replicons undergo amplification in differentiating cells (a pre-requisite for progeny virus production), these amplified viral DNA genomes may not be subject to methylation owing to an absence of DNMT activity in differentiated cells, titration of DNMT or other components of the methylation machinery due to increased copies of the viral DNA, or the sequestration of newly synthesized viral genomes from the methylation apparatus, for example, by their encapsidation into virions. With the method used for inducing differentiation in this study, i.e. culturing the cells in high calcium and high serum, we have previously documented the accumulation of progeny virions (Flores et al., 1997).

DNA methylation is known to repress cellular genes (Bird, 2002) and genes of some viruses (Robertson, 2000) by two different mechanisms, namely through the effect of methylated DNA binding proteins and associated HDACs on the chromatin structure, and due to the interference of meCs with the binding of certain transcription factors. There are presently at least three lines of evidence that DNA methylation affects the transcription of HPV genes in undifferentiated cells by these mechanisms, namely the lack of transcription of in vitro methylated HPV-16 genomes after transfection into cell cultures (Rösl et al., 1993), the repression of hypermethylated HPV-16 genomes in CaSki cells (Badal et al., 2003; van Tine et al., 2004; Kalantari et al., 2004), and the interference of CpG methylation with the binding of the papillomavirus transcription factor E2 (Thain et al., 1997; Kim et al., 2003). It is therefore concluded that documentation of HPV-16 DNA methylation in cell culture and in clinical samples can be used as a tool to infer the transcriptional modulation of HPV-16 in vivo. Transcriptional modulation could not be detected in our study wherein we induced the differentiation of cells, most likely because the hypomethylated, amplified 13 genomes in these cells get packaged into virions and therefore are sequestered from further transcription (see above).

The methylation state of integrated HPV-16 genomes is established as a consequence of the recombination event

Continued expression of the oncoproteins E6 and E7 is required for continued growth of HPV associated neoplasia and cell cultures derived from such lesions (Francis et al., 2000). Consequently, it is not surprising that the LCR of the one or two HPV-16 genomes of SiHa cells lacks any meCpGs (Badal et al., 2003; Kalantari et al., 2004) in the same way as the few viral genomes of the W12 clones 20822 and 201402, all of which have type 1 integration events. While HPV-16 DNA in the precursors of these cell lines may have been a methylation target, it is reasonable to hypothesize that cells in which recombination between viral and chromosomal DNA resulted in methylated HPV-16 genomes would have lacked the oncoprotein dependent growth advantage and were therefore eliminated.

CaSki cells are a vivid example for the need for continued E6 and E7 expression, as all 500 HPV-16 genomes, recombined with different cellular loci, were targeted and repressed by DNA methylation except a single viral copy at the junction between a viral concatemer and host DNA, which continues to transcribe the oncoproteins (Kalantari et al., 2004; van Tine et al., 2004). Similar to the situation in CaSki, HPV-16 DNA was found to be largely hypermethylated in the W12 clones 20831 and 20862, but unmethylated in clone 20861. The differential outcome of these recombination events may be a consequence of flanking cellular DNA sequences, a heterochromatic environment favoring methylation, a euchromatic environment lack of methylation (Doerfler et al., 2001). The decision may also be affected by the activity of nuclear matrix attachment regions, known antagonists of DNA methylation (Stünkel et al., 2000), or the recognition of tandem repeats as genomic parasites (Yoder et al., 1997; Goll and Bestor, 2005). In the clones 20831 and 20862 with methylated HPV-16 genomes, unmethylated enhancer and promoter segments (Fig. 4) among the multiple HPV-16 genomes are likely contiguous at least in some viral genomes, and provide for the continued expression of E6 and E7 (Jeon et al., 1995; Jeon and Lambert, 1995).

The tandem arrangement of viral DNA present in type 2 integrants alone does not suffice to establish a methylation target, as clone 20861 contains multiple concatemeric HPV-16 genomes, all of which remained unmethylated. 20861 has a tenfold higher E6/E7 expression level than 20831 and 20862, although only half as many HPV-16 genome copies (Jeon et al., 1995; Jeon and Lambert, 1995). These previous studies also demonstrated that most of the transcripts stably accumulating in all of the type 2 integrant clonal populations of W12 cells come from the integration-disrupted junction copy(s) of the viral genome. The observation that the vast majority of copies of the viral genome are unmethylated and should therefore be transcriptionally active can be reconciled with the previous finding by there being a selective increased stability of the mRNAs arising from the junction copy (as postulated by Jeon et al., 1995; Jeon and Lambert, 1995).

HPV-16 genomes conform with other types of chromosomally integrated foreign DNA, which are known methylation targets in a variety of systems ranging from transgenic animals, knock-out clones, retrovirus and adenovirus integrations (Doerfler et al., 2001). In clinical samples, HPV-16 and HPV-18 DNA have frequently been found chromosomally integrated in cancer (Schwarz et al., 1985; Daniel et al., 1995; Kalantari et al., 2001; Luft et al., 2001; Hudelist et al., 2004; Arias-Pulido et al., 2006). Consequently, HPV-16 DNA methylation may be a normal part of cancer progression and may affect all those HPV genome copies that are not required to maintain the transformed state. Methylated HPV-16 DNA, particularly in the L1 gene, may actually be used to diagnose progression, as proposed for HPV-18 (Turan et al., 2006; Turan et al, 2007).

Differentiation does not alter the methylation of HPV-16 genomes that are tandemly integrated into chromosomal DNA

In contrast to the W12E clones 20850 and 20863 with extrachromosomal HPV-16 DNA replicons, cellular differentiation did not lead to a loss of methylation in the W12I clones 20831 and 20862. The most likely explanation for this difference would be that the mechanism for establishment of methylation of chromosomally integrated DNA is fundamentally different from the mechanisms affecting extrachromosomal viral DNAs, resulting in a failure to abrogate methylation during differentiation in the same way as it happens to extrachromosomal copies of the viral genome. This could result if the possible heterochromatic environment of these recombinant virus genomes is the primary source of methylation rather than the activity of CDP and YY1 as outlined above.

The effect of 5-Aza-CdR on HPV-16 methylation

5-Aza-CdR reduces DNA methylation, as this compound forms covalent complexes with the maintenance DNA methyl transferase DNMT1, thereby inducing elimination of this enzymatic activity (Bird, 2002). We reproducibly observed that CaSki cells lost viability under the influence of 5-Aza-CdR concomitant with reduction, but not complete elimination of HPV-16 DNA methylation. Loss of viability may be a result of the demethylation and transcriptional activation of HPV-16, as 5-Aza-CdR did not show any inhibitory effect on SiHa (with a single unmethylated HPV-16 genome) and HeLa cells (with multiple unmethylated HPV-18 genomes). One possible explanation would be that extremely high concentrations of HPV gene products (exceeding those observed in the 20861 clone) could be toxic to the host cell. This explanation would require that many HPV-16 genomes become demethylated in some, but not simultaneously in all cells, as we could not detect complete demethylation nor transcriptional induction of the whole 5-Aza-CdR treated cell population. Alternatively, strong expression of normally silenced, hypermethylated cellular genes may induce this cytotoxicity, perhaps in combination with increased viral gene expression. That the type 2 integrated W12I clone, 20861, which has hypomethylated HPV-16 genomes and high level E6/E7 expression is also sensitive to 5-Aza-CdR mediated growth suppression (data not shown) argues that demethylation of one or more cellular genes is driving the growth suppression. Under our cell culture conditions, we could not reproduce the 5-Aza-CdR dependent transcriptional induction described by others (van Tine et al., 2004). In that prior study, the investigators found by FISH, that this observed transcriptional induction only arose in a minority of Aza-C treated Caski cells, perhaps explaining why we did not observe it in our population based Rt-PCR based quantification. Like in our study the prior study also noted cytotoxicity in 5-Aza-CdR treated Caski cells.

Conclusions and open questions

HPV-16 genomes are targeted in cervical cells and cell lines by at least two different mechanisms: (i) Extrachromosomal viral DNA replicating in undifferentiated cells is moderately methylated throughout the enhancer-promoter segment, and this methylation is lost upon differentiation. We think that a cascade of epigenetic conversation starting with the factors CDP and YY1 that are abundant in undifferentiated cells and bind HPV-16 DNA may explain this type of methylation, and methylation would be eliminated by replication subsequent to disappearance of CDP and YY1 in differentiated cells. Future research has to address the exact nature of all components that participate in this epigenetic regulation, and the questions whether this mechanism is cell type specific (e.g. takes place in the foreskin in a similar way as in the cervical mucosa). (ii) Upon linearization of the HPV-16 genome and recombination with chromosomal DNA, methylation may target the viral DNA in a similar way as any type of external DNA irrespective of its genetic content through effects from flanking heterochromatic and euchromatic sequences. In addition, the linearization of the viral DNA uncouples transcriptional regulation of viral L1 gene 5’ from the LCR from the influence of the viral enhancer and promoters. The ensuing lack of transcription may further stimulate methylation. As a consequence, the diagnosis of L1 methylation is likely a powerful biomarker of carcinogenic progression, independent of its role in the context of the viral life cycle, and will be evaluated in clinical studies.

MATERIALS AND METHODS

Origin and culture of W12 cells and its derivatives

W12 cells have been derived from a cervical intraepithelial neoplasia (Stanley et al., 1989) and contain approximately 1000 intact extrachromosomal HPV-16 genome copies per cell. The laboratory of one of us (P.F.L.) established two W12 subclones (termed 20850 and 20863, and commonly referred to as W12E clones) that have retained a high copy number of extrachromosomal HPV-16 genomes. In two other clones (20822 and 201402, referred to as W12I clones with type 1 integration pattern), three and five HPV-16 genomes were found recombined with the cellular DNA. In Southern blot analyses, these clones did not exhibit full length HPV-16 DNA after cleavage with restriction enzymes with unique sites in the viral genome, but rather only junction fragments, likely due to individual integration of all viral genomes, reminiscent of the carcinoma derived cell line SiHa with one or two HPV-16 genomes (Baker et al., 1987; O’Leary et al., 1994). These clones had been referred to as type 1 integrants. Yet three other W12l clones (20831, 20861, and 20862) with 30–60 recombined viral genomes contained full-length viral genomes as well as junction fragments, similar to the carcinoma derived cell line CaSki with 500 HPV-16 genomes (referred to as type 2 integrants) (Jeon and Lambert, 1995a and b).

For maintenance in an undifferentiated state, all seven W12 clones were maintained below confluence on mitomycin C-treated J2 3T3 feeder cells in F medium (0.66 mM Ca2+) composed of three parts F-12 medium and one part Dulbecco’s modified Eagle’s medium supplemented with 5% fetal bovine serum (FBS), insulin (5 µg/ml), cholera toxin (8.4 ng/ml), adenine (24 µg/ml), epidermal growth factor (10 ng/ml) and hydrocortisone (0.4 µg/ml).

In order to induce epithelial differentiation (Flores and Lambert, 1997), the W12 clones were grown to confluence on J2 3T3 feeder cells in F medium (0.66 mM Ca2+), and then maintained in F medium containing 1.2 mM Ca2+ and 20% FBS for 2–10 days. Cells were removed from dishes by treatment with 0.1% trypsin- 0.5 mM EDTA, and DNA was prepared by standard procedures. These conditions induce stratification and differentiation of W12 cells (Flores and Lambert, 1997).

Growth of CaSki cells in the presence of azacytidine

CaSki cells were grown in DME with 10% FBS in the absence and presence of 5-aza-2’-deoxycytidine (5-Aza-CdR) at concentrations of 1 and 5 µM for three and five days, respectively, followed by DNA preparation by standard procedures.

Bisulfite modification

For bisulfite modification (Frommer et al., 1992), 50–1000 ng of sample DNA supplemented with 1 µg of salmon sperm DNA in a total volume of 18 µl in water were denatured with 2 µl of 3 M NaOH and incubated at 37 °C. After denaturation, 278 µl of 4.8 M sodium bisulfite and 2 µl of 100 mM hydroquinone were added. In some experiments, we used a bisulfite kit supplied by Zymo Research Inc. (EZ bisulfite modification kit). Controls showed identical experimental outcome whether this kit or our own reagents were used. The mixture was incubated in a thermal cycler for 20 cycles of 15 minutes at 55 °C and 30 seconds at 95 °C. The modified DNA was desalted with the QIAquick PCR purification protocol and desulfonated thereafter by adding 5.5 µl of 3 M NaOH and 5 µg glycogen prior to 15 min incubation at 37 °C. The DNA was precipitated with 5.6 µl of 3 M sodium acetate and 150 µl of 100% ethanol, followed by centrifugation. The pellet was washed with 70% ethanol and dissolved in 30–50 µl TE buffer (10mM Tris-HCl pH 8, 1 mM EDTA).

Polymerase chain reactions, primers, T/A cloning and DNA sequencing

The modified DNA was amplified in form of three amplicons: Part of the L1 gene and the 5’LCR with the primers 16msp3F (position 7049–7078, AAGTAGGATTGAAGGTTAAATTAAAATTTA) and 16msp3r (position 7590-7560, AACAAACAATACAAATCAAAAAAACAAAAA); the HPV-16 enhancer with the primers 16msp4F (position 7465–7493, TATGTTTTTTGGTATAAAATGTGTTTTT) and 16msp7R (position 7732–7703, TAAATTAATTAAAACAAACCAAAAATATAT); and the HPV-16 promoter with the primers 16msp5F (position 7748–7777, TAAGGTTTAAATTTTTAAGGTTAATTAAAT) and 16msp8R (position 115-86, ATCCTAAAACATTACAATTCTCTTTTAATA). The sequences of the primers were designed according to the genomic sequence of HPV-16 assuming conversion of all cytosine residues into uracils. PCR was carried out in a 25 µl volume containing 0.2 mM of each of the four dNTPs, 10pmol of the primers, 2 mM MgCl2 and 1 unit of Ampli Taq Gold (Perkin-Elmer). The PCR started at 94°C for 1 min, followed by 40 amplification cycles (denaturing at 94 °C for 10 sec, annealing at 58 °C for 30 sec and extension at 68 °C for 1min) with final extension at 68 °C for 7 min. The presence of PCR products was verified by agarose gel electrophoresis, and confirmed amplicons were cloned with the TOPO TA cloning kit for sequencing (Invitrogen). Cloned DNAs were sequenced by Big Dye terminator v3.1 Cycle Sequencing (Applied Biosystems).

Quantification of RNA

Real-time RT PCR followed Wang-Johanning and Johanning, 2005, with primers to detect HPV-16 E6 (nt 99–178) (Forward primer: CTGCAATGTTTCAGGACCCA; reverse primer: TCATGTATAGTTGTTTGCAGCTCTGT; probe: FAMAGGAGCGACCCGGAAAGTTACCACAGTT-BHQ), HPV-16 E7 (nt 739–816) (forward primer: AAGTGTGACTCTACGCTTCGGTT; reverse primer: GCCCATTAACAGGTCTTCCAAA; probe: FAMTGCGTACAAAGCACACACGTAGACATTCGTA- BHQ), and as a control the human ribosomal protein S9 (nt 419–504) (forward primer: ATCCGCCAGCGCCATA; reverse primer: TCAATGTGCTTCTGGGAATCC; probe: FAM-AGCAGGTGGTGAACATCCCGTCCTT-TAMRA). 200 pg total RNA was reverse transcribed and amplified using the TaqMan 1-step RT-PCR kit (Applied Biosystems) in a total volume of 25 µl containing 100 nM of each forward and each reverse primer and 150 nM of E6 or E7 TaqMan probe. Reverse transcription and thermal cycling conditions were 30 minutes at 48°C followed by 10 minutes at 95 °C and 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. A negative control excluding the reverse transcription was run for each reaction by excluding the MultiScribe enzyme mix. Human ribosomal protein S9 primers and probe were used for normalization of the reactions and as control for RNA integrity. The reactions were quantified with an ABIprism 7900HT instrument and the results were analyzed using AbiPrism's SDS v2.1 software.

ACKNOWLEDGEMENTS

Our research was supported by NIH grants R01 CA-91964 (H.U.B.) and P01 CA022443 (P.F.L.) and by funds from the Chao Family Comprehensive Cancer Center of the University of California Irvine to H.U.B.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  1. Ai W, Narahari J, Roman A. Yin yang 1 negatively regulates the differentiation-specific E1 promoter of human papillomavirus type 6. J. Virol. 2000;74:5198–5205. doi: 10.1128/jvi.74.11.5198-5205.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arias-Pulido H, Peyton CL, Joste NE, Vargas H, Wheeler CM. Human papillomavirus type 16 integration in cervical carcinoma in situ and in invasive cervical cancer. J Clin Microbiol. 2006;44:1755–1762. doi: 10.1128/JCM.44.5.1755-1762.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Badal V, Chuang LSH, Badal S, Tang E, Villa LL, Wheeler CM, Li BFL, Bernard HU. CpG methylation of human papillomavirus-16 DNA in cervical cancer cell lines and in clinical specimens: genomic hypomethylation correlates with carcinogenic progression. J. Virol. 2003;77:6227–6234. doi: 10.1128/JVI.77.11.6227-6234.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baker CC, Phelps WC, Lindgren V, Braun MJ, Gonda MA, Howley PM. Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines. J Virol. 1987;61:962–971. doi: 10.1128/jvi.61.4.962-971.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Balderas-Loaeza A, Anaya-Saavedra G, Ramirez-Amador VA, Guido-Jimenez MC, Kalantari M, Calleja-Macias IE, Bernard HU, Garcia-Carranca A. Human papillomavirus-16 DNA methylation patterns support a causal association of the virus with oral squamous cell carcinomas. Int. J. Cancer. 2007;120:2165–2169. doi: 10.1002/ijc.22563. [DOI] [PubMed] [Google Scholar]
  6. Bernard HU. Gene Expression of Genital Human Papillomaviruses and Potential Antiviral Approaches. Antiviral Therapy. 2002;7:219–237. [PubMed] [Google Scholar]
  7. Bhattacharjee B, Sengupta D. CpG methylation of HPV 16 LCR at E2 binding site proximal to P97 is associated with cervical cancer in presence of intact E2. Virology. 2006;354:280–285. doi: 10.1016/j.virol.2006.06.018. [DOI] [PubMed] [Google Scholar]
  8. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002;16:6–21. doi: 10.1101/gad.947102. [DOI] [PubMed] [Google Scholar]
  9. Collins AS, Nakahara T, Do A, Lambert PF. Interactions with pocket proteins contribute to the role of human papillomavirus type 16 E7 in the papillomavirus life cycle. J Virol. 2005;79:14769–14780. doi: 10.1128/JVI.79.23.14769-14780.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Daniel B, Rangarajan A, Mukherjee G, Vallikad E, Krishna S. The link between integration and expression of human papillomavirus type genomes and cellular changes in the evolution of cervical ntraepithelial neoplastic lesions. J Gen Virol. 1997;78:1095–1101. doi: 10.1099/0022-1317-78-5-1095. [DOI] [PubMed] [Google Scholar]
  11. DelMar-Pena LM, Laimins LA. Differentiation-dependent chromatin rearrangement coincides with activation of human papillomavirus type 31 late gene expression. J. Virol. 2001;75:10005–10013. doi: 10.1128/JVI.75.20.10005-10013.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Demeret C, Desaintes C, Yaniv M, Thierry F. Different mechanisms contribute to the E2 mediated transcriptional repression of human papillomavirus type 18 viral oncogenes. J. Virol. 1997;71:9343–9349. doi: 10.1128/jvi.71.12.9343-9349.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Doerfler W, Remus R, Muller K, Heller H, Hohlweg U, Schubbert R. The fate of foreign DNA in mammalian cells and organisms. Dev. Biol. (Basel) 2001;106:89–97. [PubMed] [Google Scholar]
  14. Flores ER, Lambert PF. Evidence for a switch in the mode of human papillomavirus type 16 DNA replication during the viral life cycle. J. Virol. 1997;71:7167–7179. doi: 10.1128/jvi.71.10.7167-7179.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Francis DA, Schmid SI, Howley PM. Repression of the integrated papillomavirus E6/E7 promoter is required for growth suppression of cervical cancer cells. J. Virol. 2000;74:2679–2686. doi: 10.1128/jvi.74.6.2679-2686.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul CL. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc.Natl.Acad.Sci.USA. 1992;89:1827–1831. doi: 10.1073/pnas.89.5.1827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fuks F. DNA methylation and histone modifications: teaming up to silence genes. Curr. Opin. Genet. Dev. 2005;15:490–495. doi: 10.1016/j.gde.2005.08.002. [DOI] [PubMed] [Google Scholar]
  18. Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu.Rev.Biochem. 2005;74:481–514. doi: 10.1146/annurev.biochem.74.010904.153721. [DOI] [PubMed] [Google Scholar]
  19. Hudelist G, Manavi M, Pischinger KI, Watkins-Riedel T, Singer CF, Kubista E, Czerwenka KF. Physical state and expression of HPV DNA in benign and dysplastic cervical tissue: different levels of viral integration are correlated with lesion grade. Gynecol Oncol. 2004;92:873–880. doi: 10.1016/j.ygyno.2003.11.035. [DOI] [PubMed] [Google Scholar]
  20. Jeon S, Allen-Hoffmann BL, Lambert PF. Integration of human papillomavirus type 16 into the human genome correlates with a selective growth advantage of cells. J. Virol. 1995;69:2989–2997. doi: 10.1128/jvi.69.5.2989-2997.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jeon S, Lambert PF. Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: implications for cervical carcinogenesis. Proc. Natl. Acad. Sci. USA. 1995;92:1654–1658. doi: 10.1073/pnas.92.5.1654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kalantari M, Blennow E, Hagmar B, Johansson B. Physical state of HPV16 and chromosomal mapping of the integrated form in cervical carcinomas. Diagn Mol Pathol. 2001;10:46–54. doi: 10.1097/00019606-200103000-00008. [DOI] [PubMed] [Google Scholar]
  23. Kalantari M, Calleja-Macias IE, Tewari D, Hagmar B, Barrera-Saldana HA, Wiley DJ, Bernard HU. Conserved methylation patterns of human papillomavirus-16 DNA in asymptomatic infection and cervical neoplasia. J. Virol. 2004;78:12762–12772. doi: 10.1128/JVI.78.23.12762-12772.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kim K, Garner-Hamrick PA, Fisher C, Lee D, Lambert PF. Methylation patterns of papillomavirus DNA, its influence on E2 function, and implications in viral infection. J. Virol. 77:12450–12459. doi: 10.1128/JVI.77.23.12450-12459.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Klose RJ, Sarraf SA, Schmiedeberg L, McDermott SM, Stancheva I, Bird A. DNA binding selectivity of MeCP2 due to a requirement for A/T sequence adjacent to methyl-CpG. Cell. 2005;19:667–678. doi: 10.1016/j.molcel.2005.07.021. [DOI] [PubMed] [Google Scholar]
  26. Luft F, Klaes R, Nees M, Durst M, Heilmann V, Melsheimer P, von Knebel Doeberitz M. Detection of integrated papillomavirus sequences by ligation-mediated PCR (DIPS-PCR) and molecular characterization in cervical cancer cells. Int J Cancer. 2001;92:9–17. [PubMed] [Google Scholar]
  27. Nishio H, Walsh MJ. CCAAT displacement protein/cut homolog recruits G9a histone lysine methyltransferase to repress transcription. Proc. Natl. Acad. Sci. USA. 2004;101:11257–11262. doi: 10.1073/pnas.0401343101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. O'Connor MJ, Tan SH, Tan CH, Bernard HU. YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity. J. Virol. 1996;70:6529–6539. doi: 10.1128/jvi.70.10.6529-6539.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. O'Connor MJ, Stünkel W, Koh CH, Zimmermann H, Bernard HU. The differentiation-specific factor CDP/Cut represses transcription and replication of human papillomaviruses. J. Virol. 74:401–410. [PMC free article] [PubMed] [Google Scholar]
  30. O'Leary JJ, Browne G, Johnson MI, Landers RJ, Crowley M, Healy I, Street JT, Pollock AM, Lewis FA, Andrew A. PCR in situ hybridization detection of HPV 16 in fixed CaSki and fixed SiHa cell lines. J. Clin. Pathol. 1994;47:933–938. doi: 10.1136/jcp.47.10.933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pattison S, Skalnik DG, Roman A. CCAAT displacement protein, a regulator of differentiation-specific gene expression, binds a negative regulatory element within the 5’ end of the human papillomavirus type 6 log control region. J. Virol. 1997;71:2013–2022. doi: 10.1128/jvi.71.3.2013-2022.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rezai-Zadeh N, Zhang X, Namour F, Fejer G, Wen YD, Yao YL, Gyory I, Wright K, Seto E. Targeted recruitment of a histone H4-specific methyltransferase by the transcription factor YY1. Genes Dev. 2003;17:1019–1029. doi: 10.1101/gad.1068003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Robertson KD. The role of DNA methylation in modulating Epstein-Barr Virus gene expression. In: Jones PA, Vogt PK, editors. DNA methylation and cancer. Berlin: Springer; 2000. pp. 21–34. [DOI] [PubMed] [Google Scholar]
  34. Rösl F, Arab A, Klevenz B, zur Hausen H. The effect of DNA methylation on gene regulation of human papillomaviruses. J. Gen.Virol. 1993;74:791–801. doi: 10.1099/0022-1317-74-5-791. [DOI] [PubMed] [Google Scholar]
  35. Schwarz E, Freese UK, Gissmann L, Mayer W, Roggenbuck B, Stremlau A, zur Hausen H. Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature. 1985;314:111–114. doi: 10.1038/314111a0. [DOI] [PubMed] [Google Scholar]
  36. Shai A, Brake T, Somoza C, Lambert PF. The human papillomavirus E6 oncogene dysregulates the cell cycle and contributes to cervical carcinogenesis through two independent activities. Cancer Res. 2007;67:1626–1635. doi: 10.1158/0008-5472.CAN-06-3344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Stanley MA, Browne HM, Appleby M, Minson AC. Properties of a non-tumorigenic human cervical keratinocyte cell line. Int. J. Cancer. 1989;43:672–676. doi: 10.1002/ijc.2910430422. [DOI] [PubMed] [Google Scholar]
  38. Stünkel W, Bernard HU. The chromatin structure of the long control region of human papillomavirus type 16 represses viral oncoprotein expression. J. Virol. 1999;73:1918–1930. doi: 10.1128/jvi.73.3.1918-1930.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stünkel W, Huang Z, Tan SH, O’Connor M, Bernard HU. Nuclear matrix attachment regions of human papillomavirus-16 repress or activate the E6 promoter depending on the physical state of the viral DNA. J. Virol. 2000;74:2489–2501. doi: 10.1128/jvi.74.6.2489-2501.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tan SH, Leong LEC, Walker PA, Bernard HU. The human papillomavirus type 16 transcription factor E2 binds with low cooperativity to two flanking binding sites and represses the E6 promoter through displacement of Sp1 and TFIID. J. Virol. 1994;68:6411–6420. doi: 10.1128/jvi.68.10.6411-6420.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Thain A, Jenkins O, Clarke AR, Gaston K. CpG methylation directly inhibits binding of the human papillomavirus type 16 E2 protein to specific DNA sequences. J. Virol. 1996;70:7233–7235. doi: 10.1128/jvi.70.10.7233-7235.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Turan T, Kalantari M, Calleja-Macias IE, Villa LL, Cubie HA, Cuschieri K, Skomedal H, Barrera-Saldana HA, Bernard HU. Methylation of the human papillomavirus-18 L1 gene: a biomarker of neoplastic progression? Virology. 2006;349:175–183. doi: 10.1016/j.virol.2005.12.033. [DOI] [PubMed] [Google Scholar]
  43. Turan T, Kalantari M, Cuschieri K, Cubie HA, Skomedal H, Bernard HU. High-throughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia. Virology. 2007;361:185–191. doi: 10.1016/j.virol.2006.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Van Tine BA, Kappes JC, Banerjee NS, Knops J, Lai L, Steenbergen RD, Meijer CL, Snijders PJ, Chatis P, Broker TR, Moen PT, Jr, Chow LT. Clonal selection for transcriptionally active viral oncogenes during progression to cancer. J. Virol. 2004;78:11172–11186. doi: 10.1128/JVI.78.20.11172-11186.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang-Johanning F, Johanning GL. Viral detection. Methods Mol. Biol. 2005;292:3–14. doi: 10.1385/1-59259-848-x:003. [DOI] [PubMed] [Google Scholar]
  46. Wiley DJ, Huh J, Chang C, Kalantari M, Rao JY, Goetz M, Msongsong E, Poulter M, Bernard HU. Methylation of human papillomavirus DNA in samples of HIV-1 infected men screened for anal cancer. J. Acqu. Immunodef. Syndr. 2005;39:143–151. [PubMed] [Google Scholar]
  47. Yoder JA, Walsh CP, Bestor TH. Cytosine methylation and the ecology of intragenomic parasites. Trends Gen. 1997;13:335–340. doi: 10.1016/s0168-9525(97)01181-5. [DOI] [PubMed] [Google Scholar]
  48. Zhao W, Noya F, Chen WY, Townes TM, Chow LT, Broker T. Trichostatin A up-regulates human papillomavirus type 11 upstream regulatory region-E6 promoter activity in undifferentiated primary human keratinocytes. J. Virol. 1999;73:5026–5033. doi: 10.1128/jvi.73.6.5026-5033.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES