Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for real time PCR analysis
| Genes | Primers |
| RPL13a (reference gene) | Forward : atccctccaccctatgacaa |
| Reverse : gccccaggtaagcaaactt | |
| cFOS | Forward : gggacagcctttcctactacc |
| Reverse : gatctgcgcaaaagtcctgt | |
| cJUN | Forward : agggacccatggaagttttt |
| Reverse : tttttctaggagttgtcagattcaaa |
