Table 2.

Primers used in this study

Name	Sequence (5′–3′)*	Usage
UphypA	ataggtgcatcaccgcctactg	Construction of hypA and hh0809 mutant
RevhypA	tttgctcaatggcgcgaagg	Construction of hypA and hh0809 mutant
UphypB	gccaaacacattcttgctcc	Construction of hypB mutant
Revhyp B	cgcgagtattagtttcgccc	Construction of hypB mutant
UphypC	ttgtgagcaaggcagatatg	Construction of hypC mutant
Revhyp C	cttcaagcactataatagg	Construction of hypC mutant
HypC-ery1	GCGATACCGTCGAGATtacaactgccatattattg	Construction of hypC mutant
HypC-ery2	CTAGCGATAAGCTTgatacattaggcgtgag	Construction of hypC mutant
UpureE	ggcttacaggctggattgaaag	Construction of ureE mutant
RevureE	tgcacatagctttctagccc	Construction of ureE mutant
UpureG	ctcaaagcgatgggcaagag	Construction of ureG mutant
RevureG	atcctcatcttctagtgggc	Construction of ureG mutant
UreGmut1	AGAGAAGAAgcttctatgaatcttg	Creation of HindIII within ureG
UreGmut2	TCATAGAAGCTtcttctctgattgctg	Creation of HindIII within ureG

^*Lower-case letters indicate H. hepaticus-derived sequences and bold letters indicate newly generated restriction sites. ery-specific sequences are underlined. All primers were purchased from Integrated DNA Technology (IDT).