Abstract
Peptide nucleic acids (PNAs) are a nonionic DNA/RNA mimic that can recognize complementary sequences by Watson–Crick base–pairing. The neutral PNA backbone facilitates recognition of duplex DNA by strand invasion, suggesting that antigene PNAs (agPNAs) can be important tools for exploring the structure and function of chromosomal DNA inside cells. However, before agPNAs can enter wide use it will be necessary to develop straightforward strategies for introducing them into cells. Here we demonstrate that agPNA–peptide conjugates can target promoter DNA and block progesterone receptor (PR) gene expression inside cells. Thirty–six agPNA–peptide conjugates were synthesized and tested. We observed inhibition of gene expression using cationic peptides containing either arginine or lysine residues, with eight or more cationic amino acids being preferred. Both thirteen and nineteen base agPNA-peptide conjugates were inhibitory. Inhibition was observed in human cancer cell lines expressing either high or low levels of progesterone receptor. Modification of agPNA–peptide conjugates with hydrophobic amino acids or small molecule hydrophobic moities yielded improved potency. Inhibition by agPNAs did not require cationic lipid or any other additive, but adding agents to cell growth media that promote endosomal release caused modest increases in agPNA potency. These data demonstrate that chromosomal DNA is accessible to agPNA–peptide conjugates and that chemical modifications can improve potency.
Peptide nucleic acids1 (PNAs) are a class of DNA/RNA mimic with an uncharged amide backbone (1). PNAs hybridize to complementary sequences by Watson–Crick base–pairing and have an outstanding ability to invade double–stranded DNA (1-5). Reports have appeared suggesting that PNAs can also target duplex DNA inside cells (6-8). Recently, we reported that antigene PNAs (agPNAs) that target chromosomal DNA at transcription start sites inhibit gene expression (9). These data suggest that PNAs may be valuable tools for exploring promoter function and for controlling gene expression at the level of the chromosome.
For our initial experiments with agPNAs, we delivered them into cultured human cells in complex with complementary DNA oligonucleotides and cationic lipid (9,10). This method is a variation of standard protocols for lipid–mediated transfection. The DNA binds to the PNA, the lipid binds to the DNA, and the PNA is transported into cells as cargo by the DNA/lipid complex.
This method has worked well and can lead to potent inhibition of gene expression in the presence of nanomolar concentrations of agPNA (9,10). However, the combination of steps (annealing DNA and PNA, lipid transfection) is likely to discourage full exploitation of the substantial potential of agPNAs as tools for probing chromosomal DNA in cell culture. Animal studies or clinical applications would be complicated by the need to include a lipid/DNA carrier complex that might increase the likelihood of unexpected toxic effects.
Developing agPNAs in the routine laboratory investigations or clinical development requires a simple delivery strategy. An alternate approach for introducing PNAs into cells is the design and synthesis of chemically modified PNAs that possess improved cellular activity. Many peptides possess the ability to enhance the transport of macromolecules into the cell (11). Investigators have synthesized antisense PNA–peptide conjugates that inhibit mRNA translation (12,13), transcription (14), or TAT– dependent transactivation (15,16), or alter mRNA splicing (17-20). Positively charged amino acids are the outstanding feature of most of these peptides, but no one design has emerged as optimal.
Another strategy for improving cellular uptake is to alter cell culture conditions to facilitate the entry of PNA-peptide conjugates into cells. PNA–peptide conjugates are internalized through endocytosis (21-24). Microscopy shows that most PNA localizes to endosomal compartments and is not available for recognition of cellular nucleic acids. To improve the pool of active PNA, Nielsen and colleagues added calcium ions or chloroquine to cell culture media to promote rupture of endosomes and release of PNA–peptide conjugates from the endosome (21). Lebleu and colleagues have achieved similar results using chloroquine or 0.5 M sucrose (22). Most recently, Koppelhus has shown that the presence of serum in media can have a dramatic negative effect for uptake of some conjugates (23). Issues surrounding the cellular import of PNAs have recently been reviewed (24).
Here we test the hypothesis that agPNA–peptide conjugates can enter cells, target chromosomal DNA, and block gene expression. We report extensive testing of varied agPNA–peptide and agPNA–small molecule conjugates under normal and modified cell culture conditions. We find that agPNA-peptide conjugates can inhibit gene expression and that the chemical properties of the peptide dictate potency.
MATERIALS AND METHODS
Synthesis of PNA–Peptide Conjugates
PNA–peptide conjugates were synthesized as previously described (25) on an Expedite 8909 synthesizer (Applied Biosystems, Foster City CA) using reagents obtained from Applied Biosystems. Undecanoic acid, palmitic acid, linoleic acid, and nonadecanoic acid were obtained from Aldrich. (Cholesteryloxy)acetic acid was prepared as described (26). Hydrophobic moieties were attached manually to the N–terminus of PNAs. PNA–peptides were first synthesized on the Expedite synthesizer, after deblocking the final Fmoc protecting group, the resins were stirred with 10 equivalent of fatty acid/HBTU/HOBT with 20 equivalent of DIPEA in 1 mL anhydrous dichloromethane/DMF(1:1) overnight. All PNAs contained a C–terminal lysine and peptides or hydrophobic moieties were attached at the N–terminal. PNA–peptide conjugates were purified by C–18 reversed phase HPLC and assay by MALDI-TOF mass spectral analysis as previously described (25).
Cell Culture
T47D or MCF-7 breast cancer cells were obtained from the American Type Culture Collection (ATCC). Cells were cultured and PNAs transfected as described (10). Briefly, two days prior to transfection, T47D or MCF–7 cells were plated in 6–well plates at 80,000 cells per well in RPMI media (ATCC) supplemented with10% heat inactivated fetal bovine serum (FBS, Gemini Bioproducts), 0.4 units/mL of bovine insulin, 0.5% MEM nonessential amino acids (Sigma). After two days, the PNA– peptide conjugates were first prepared at a stock concentration of 100 μM in phosphate buffered saline (PBS, 2.7 mM KCl, 136 mM NaCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.1–7.5, Sigma) and then diluted to the appropriate concentration in supplemented RPMI media without antibiotics. After 48 hours, the media containing PNA was removed and replaced by fresh supplemented RPMI media. When cells reach confluence, typically 3–4 days after addition of PNA, they were passaged and re–plated in 6–well plates. The cells were then transfected a second time as described above and harvested upon reaching confluence.
In calcium chloride or chloroquine supplementation experiments, CaCl2 or chloroquine was added with PNAs to cells in OptiMEM (GIBCO) at desired concentration. After 4 h incubation, the cells were added with 1.2 mL/well of supplemented RPMI media for another 20 h. Five days later, the cells were transfected a second time.
Analysis of PR Expression
Cells were harvested by washing the cells once with 1 × PBS buffer, aspirated, and treated with a trypsin solution (0.05 % Trypsin, 0.53 mM EDTA· 4Na, Invitrogen) at 37 °C for 2 min. The contents of each well were transferred separately into 1.5 mL microfuge tubes and centrifuged at 3500 rpm for 15 min at 4 °C. Cells were then lysed with 40–50 μL of ice–cold lysis buffer (120 mM Tris–base, pH 7.4, 120 mM NaCl, 1 mM Na2–EDTA, 1 mM DTT, 10 mM ß–glycerophosphate, 0.1 mM sodium fluoride, 0.1 mM sodium vanadate, 0.5 % v/v Nonidet P–40) containing Complete Protease Inhibitor Cocktail (Roche, Indianapolis, IN). Tubes were vortexed for 10–20 s with short bursts and then frozen. After thawing on ice, samples were centrifuged at 12000 rpm for 15 min at 4°C to pellet debris.
Protein concentration was determined for each sample in a 96–well plate format by the BCA method (Piece, Rockford, IL). Western analysis by SDS–PAGE was performed using standard methods. The membranes were blocked with 5% milk/PBS–Tween (Sigma) for 1 h and placed on a rocker platform with primary antibody rabbit polyclonal anti-PR (Cell Signaling, MA) in 5% milk/PBS–Tween (1:1000) overnight at 4 °C. The membranes were washed twice for 5 min each in PBS–Tween. Secondary antibody conjugate (HRP conjugate goat anti–rabbit or goat anti–mouse) were diluted 1: 5000 in 5% milk/PBS–Tween and placed on a rocker platform for 45 min at room temperature. Membranes were then washed three times with 15 min each in PBS–Tween. Each membrane was incubated for 4 min in 4 mL of Super Signal West Pico Chemiluminescent substrate (Pierce), then drained, placed in a transparent sheet protector, exposed to BioMax Light film (Eastman Kodak Company, Rochester, NY) for 1–60 s, and developed according to manufacture's recommendations.
Control antibody was mouse anti–β–actin (Sigma). Some modifications were made for detecting the weak PR signal in MCF–7 cells. First, loading 50% more protein samples to run the gels (30 μg/well instead of 20 μg/well). Second, the incubation time with secondary antibody was prolonged to 1h. Third, the exposure time to film was extended to 2–8 min before developing.
RESULTS
Design of PNA–Peptide Conjugates Targeting Human Progesterone Receptor
We designed PNAs to be complementary to DNA sequences within the promoter region for human progesterone receptor (PR) (27,28). PR has two major isoforms, PR–B and PR–A. Each isoform has its own promoter, and the PR–B promoter is approximately 800 bases upstream from the promoter for PR–A. The PNAs used in this study were complementary to the template strand of the promoter at the transcription start site for PR–B and have no complementarity to PR mRNA. For simplicity, all quantifications of protein expression are based on levels of PR–B.
Many different peptide import sequences have been described in the literature (11). Because most of these published sequences are cationic, we designed peptides to contain lysine or arginine residues. Some synthetic peptides also contained hydrophobic amino acids or attached hydrophobic small molecules to test the effect on cellular delivery of manipulating hydrophobicity.
Antigene Inhibition by PNA–Lysine Conjugates
We initiated our study of agPNA–peptide conjugates by synthesizing nineteen base PNA–peptide conjugates containing varying numbers of lysine residues (Table 1, conjugates 2–7). For comparison, we also synthesized an analogous PNA that lacked a peptide (PNA 1) and a PNA conjugate (conjugate 30) that was complementary to PR mRNA. We had previously shown that antisense PNAs coupled to the (AAKK)4 peptide could inhibit expression of human caveolin (13) and we anticipated that the anti–PR antisense PNA would serve as a useful positive control for assaying agPNAs.
Table 1.
PNA–peptide conjugates
| PNA | Peptide | Hydrophobic Group |
Molecular Weight Expected/Found |
|---|---|---|---|
| 19 base PNA complementary to hPR promoter TGTCTGGCCAGTCCACAGC | |||
| 1 | none | none | 5251/5248 |
| 2 | K8 | none | 6278/6278 |
| 3 | D–K4 | none | 5765/5762 |
| 4 | D–K8 | none | 6278/6285 |
| 5 | D–K10 | none | 6535/6541 |
| 6 | D–(AAKK)4 | none | 6847/6847 |
| 7 | D–K12 | none | 6791/6787 |
| 8 | RKKRRQRRR | none | 6573/6572 |
| 9 | R8 | none | 6501/6500 |
| 10 | R12 | none | 7126/7130 |
| 11 | D–R8 | none | 6501/6498 |
| 12 | D–R12 | none | 7126/7122 |
| 13 | R8F2 | none | 6795/6788 |
| 14 | R8F4 | none | 7090/7091 |
| 15 | R8W2 | none | 6873/6869 |
| 16 | R8W4 | none | 7246/7242 |
| 17 | R8H4 | none | 7050/7052 |
| 18 | R5R5(branched) | none | 6942/6925 |
| 19 | K4K4(branched) | none | 6405/6403 |
| 20 | none | C18 | 5532/5534 |
| 21 | R8 | C10 | 6669/6666 |
| 22 | R8 | C15 | 6739/6738 |
| 23 | R8 | C18 | 6781/6783 |
| 24 | K8 | C18 | 6558/6555 |
| 25 | R8H4 | C18 | 7329/7328 |
| 26 | R12 | C18 | 7406/7403 |
| 27 | R8 | cholyl | 6891/6887 |
| 28 | R8 | linoleoyl | 6762/6762 |
| 29 | R8 | cholesteryl | 6926/6924 |
| PNA–peptide conjugate complementary to hPR mRNA TTGCCTTCAGCTCAGTCAT | |||
| 30 | D–(AAKK)4 | none | 6847/6847 |
| 13 base PNA complementary to hPR promoter TGTCTGGCCAGTC | |||
| 31 | R8 | none | 4904/4902 |
| 15 base PNA complementary to hPR promoter TGTCTGGCCAGTCCA | |||
| 32 | R8 | none | 5431/5436 |
| Mismatch–containing PNA–peptide conjugate TGTATGTCCAGTACACAGC | |||
| 33 | D–K8 | none | 6301/6296 |
| 34 | R8 | none | 6524/6525 |
| 35 | R8 | C18 | 6804/6801 |
| Noncomplementary PNA–peptide conjugates ACCTACTGTCCTCGGCACCA | |||
| 36 | D–K8 | none | 6473/6471 |
| GGGTGAGAGTTCCCCATCT | |||
| 37 | R8 | C18 | 6837/6834 |
PNA sequences are listed N to C termini. All PNAs contain a C–terminal lysine. Conjugates are linked to the PNA N–terminus. Unless otherwise noted peptides contain lysine or arginine residues in the L configuration.
PNA 1 and the PNA–peptide conjugates were mixed with media and added directly to T47D breast cancer cells. Cells were harvested after reaching confluence and levels of PR protein were evaluated by Western analysis. We observed inhibition of PR expression by conjugates 4, 5, and 7 containing eight, ten, or twelve lysines respectively (Figure 1 A). These conjugates exhibited similar potencies (IC50 values of 3–5 μM) when added to cells at varying concentrations (Figure 1 B, C, and D).
FIGURE 1.

Western analysis of inhibition of PR protein expression by agPNA-lysine conjugates. (A) Inhibition of PR expression by various agPNA conjugates at 6 μM. Lane 1, PNA 1; Lane 2, Conjugate 2 (L-K8); Lane 3, Conjugate 3 (D-K4) Lane 4 Conjugate 4, (D-K8); Lane 5 Conjugate 5 (D-K10); Lane 6, Conjugate 7 (D-K12); Lane 7, Conjugate 6 (D-AAKK)4; Lane 8, Conjugate 30 antisense PNA (D-AAKK)4; Lane 9 Mismatch-containing conjugate 33 (D-K8). (B) Inhibition of PR expression by increasing concentrations of conjugate 4 (D-K8). (C) Inhibition of PR expression by increasing concentrations of conjugate 5 (D-K10). (D) Inhibition of PR expression by increasing concentrations of conjugate 7 (D-K12). Percentages for inhibition are relative to levels of PR expression measured after addition of mismatch conjugate 33 at the highest concentration used. ni: no significant (<10%) inhibition.
Inhibitory agPNA–peptide conjugates 4, 5, and 7 blocked expression of both PR–B and PR–A, a result that had been observed previously with agPNAs delivered into cells in complex with DNA and lipid (9) as well as with siRNAs (duplex RNAs that are complementary to mRNA) or antigene RNAs (agRNAs, duplex RNAs that are complementary to promoter DNA) (29,30). Inhibition of both PR-B and PR-A was also observed by antigene locked nucleic acid (LNA) oligomers (31). These data reveal a linkage between reduced expression of PR-B and PR-A regardless of the chemical properties of the oligomers used (PNA, duplex RNA, LNA), target sequence (mRNA or promoter DNA), and the method of cellular delivery (cationic lipid or attached cationic peptide).
PNA 1, that lacked an attached peptide, and PNA conjugate 33, that contained mismatched bases, did not inhibit gene expression. These results suggested that the presence of an import peptide and complementarity to the target sequence were necessary for inhibition of PR. PNA conjugates 2 and 3 containing eight L–lysines or four D–lysines respectively showed little activity. Antisense PNA conjugate 30 containing the cationic peptide D–(AAKK)4 was also effective, but an agPNA conjugated to D–(AAKK)4 (conjugate 6) was less active.
These data from PNA 1 and PNA conjugates 2–7, 30, and 33 suggest several important conclusions; i) peptides can successfully deliver active agPNAs into cells and into the nucleus, ii) agPNA conjugates can sequence–specifically recognize a transcription start site; iii) recognition is sufficient to block gene expression, iv) gene silencing is sensitive to the number and stereochemical configuration of lysine residues but that the benefit of adding more than eight lysine residues is marginal, and v) inhibition of PR expression by PNA-peptide conjugates yields the same phenotype (linked reduction of PR-B and PR-A) also observed using different gene silencing strategies (9,29-31).
Antigene Inhibition of PR Requires Two Transfections
We did not observe significant inhibition of PR expression after treating T47D cells with PNAs once over a four–day period (data not shown). However, inhibition became apparent after fresh PNA conjugate was added at day 4 and cells were cultured for an additional 3–4 days.
It is likely that the extended incubation is necessary to allow the PNA to enter the cells, escape endosomes, enter the nucleus, associate with chromosomal DNA, reduce expression of mRNA, and reduce protein levels. Two transfections had also been necessary when introducing agPNAs into cells in complex with lipid and DNA (9). By contrast, one transfection was sufficient for efficient inhibition of gene expression by agRNAs (10,29,30). Relatively fast action by agRNAs may be due to the presence of protein machinery for recognizing duplex RNA in cells, with target location by agRNAs is assisted by argonaute proteins (30) and other cellular factors. PNAs have an unnatural backbone with a reduced ability to be recognized by cellular proteins (32), suggesting that PNAs likely find their targets with little assistance.
In an accompanying paper, we observe that similar antigene locked nucleic acid (LNA) oligomers also require two transfections and provide further discussion of the implications underlying time-dependent antigene inhibition (31).
Antigene Inhibition of PR Expression by PNA–Arginine Conjugates
We examined inhibition of PR gene expression by arginine–containing conjugates 8–17 to determine whether simply altering the identity of positively charged amino acid would have a substantial impact of the potency of agPNAs.
Conjugates 9–12 were homoarginine chains of eight or twelve residues. Conjugate 8 contained a sequence derived from HIV TAT peptide that has been extensively characterized as a cellular transport domain (33,34). Conjugates 13–17 had additional hydrophobic residues tryptophan and phenylalanine or histidine at the terminal. Conjugates 8–10 and 13–17 contained amino acids in the L–configuration, while conjugates 11 and 12 contained amino acids in the more nuclease resistant D–configuration.
Several arginine–containing conjugates were able to inhibit gene expression and greater than 50 % inhibition was achieved with conjugates 8–14 (Figure 2). The potency of inhibition by L–Arg8 and L–Arg12 conjugates 9 – 10 were similar (IC50 values of approximately 5 μM) (Figure 2 B and C). D–Arg conjugates 11 and 12 were slightly more potent, IC50 values of 2.8 and 2.4 μM respectively (Figure 2 D and E). The IC50 values for conjugates 9 – 12 were within 2–fold of values for conjugates that contain lysine (Figure 1 B–D), suggesting that the potential for directing the import of PNAs is similar regardless of which cationic amino acid is used. Conjugate 34 containing L-Arg8 peptide coupled to a mismatch-containing PNA did not inhibit gene expression.
FIGURE 2.

Western analysis of inhibition of PR protein expression by agPNA-arginine conjugates. (A) Inhibition of PR expression by various agPNA conjugates at 6 μM. Lane 1, Conjugate 8 (TAT-peptide); Lane 2, Conjugate 9 (R8); Lane 3, Conjugate 10 (R12); Lane 4, Conjugate 13 (R8F2); Lane 5, Conjugate 14 (R8F4); Lane 6, Conjugate 15 (R8W2); Lane 7, Conjugate 16 (R8W4), Lane 8 Conjugate 17 (R8H4); Lane 9 mismatch-containing conjugate 34 (R8). (B) Inhibition of PR expression by increasing concentrations of conjugate 9 (L-R8) . (C) Inhibiton of PR expression by increasing concentrations of conjugate 10 (L-R12). (D) Inhibition of PR expression by increasing concentrations of conjugate 11 (D-R8) . (E) Inhibition of PR expression by increasing concentrations of conjugate 12 (D-R12). Percentages for inhibition are relative to levels of PR expression measured after addition of mismatch conjugate 34 added at the highest concentration used. ni: no significant (<10%) inhibition.
Effect of PNA Length on Inhibition of Gene Expression by agRNAs
To test the effect of varying PNA length, we synthesized conjugates 31 and 32 with 13 or 15 base PNA domains coupled to eight L–arginines and assayed their ability to inhibit PR expression (Figure 3). 13 base conjugate 31 inhibited expression of PR protein with an IC50 value of 5 μM (Figure 3 B), similar to analogous 19 base conjugate 9 (Figure 2 B). 15 base conjugate 32 by contrast, was a relatively less efficient inhibitor (IC50 value of >8 μM) (Figure 3 C). The surprising difference in potency between 13 base conjugate 31 and 15 base conjugate 32 was confirmed by repeated experiments using two different syntheses of conjugate 32.
FIGURE 3.
Western analysis of PR protein expression by conjugates containing different length PNAs. All PNAs have the same peptide conjugates (R8). (A) Inhibition of PR expression by conjugates 9 (19 bases), 32 (15 bases), and 31 (13 bases) at 4 or 6 μM. (B) Inhibition of PR expression by increasing concentrations of conjugate 31 (13 bases). (C) Inhibition of PR expression by increasing concentrations of conjugate 32 (15 bases). Percentages for inhibition of PR expression are relative to mismatch conjugate 34 at the highest concentration used. ni: no significant inhibition.
These results suggest that relatively short agPNAs can inhibit gene expression and that antigene inhibition by PNAs is sensitive to relatively small shifts in the PNA target site or the length of the PNA. We had previously observed a similar phenomenon with antigene RNAs (agRNAs) that target the PR promoter (29,35). A one base shift in target site either upstream or downstream was sufficient to convert an inactive agRNA into an inhibitory agRNA (29) or, depending on the circumstances, an inactive agRNA into an agRNA capable of activating gene expression (35). These findings suggest that the promoter region is sensitive to small changes in the targeting agent and that it is essential to test multiple agents for activity.
Branched Chain Conjugates
Our initial experiments with antigene PNA–peptide conjugates contained linear peptide chains. Experiments by Gariepy and coworkers had suggested that altering the valency of cationic peptides could improve import of proteins (36). To investigate whether placing cationic residues on branched peptides would effect gene silencing we synthesized branched conjugates 18 with 10 arginines and 19 containing 8 lysines residues and compared their effects on PR expression to single-chain conjugate 4 and mismatch-containing conjugate 34 (Figure 4). Conjugate 18 yielded significant inhibition (86% at 6 μM) suggesting that branched cationic peptides can be used to deliver active antigene PNAs. Conjugate 19 showed no significant activity upon repeated assay.
FIGURE 4.

Western analysis of PR protein expression by branch chain PNA conjugates at 6 μM. Lane 1, Conjugate 4 (D-K8); Lane 2, Conjugate 9 (L-R8); Lane 3, branched lysine conjugate 19; Lane 4, branched arginine conjugate 18; Lane 5. Mismatch conjugate 34 (L-R8).
Effect of Additives and Varying Cell Culture Conditions
Previous reports have suggested that PNA–peptide conjugates enter cells by endocytosis and that release from endosomes into the cytoplasm limits the potency of gene silencing (21,22). These reports have indicated that addition of Ca2+ cation or chloroquine to cultured cells can improve the activity of antisense PNA–peptide conjugates by increasing release from the endosomes and suggests a simple strategy for improving the potency gene silencing by PNAs.
To test whether additives would also improve gene silencing by antigene PNAs we introduced Ca2+ (Figure 5) or chloroquine (Figure 6) into cell media. Consistent with previous reports using Ca2+ to improve the activity of antisense PNAs, we observed that addition of Ca2+ also increased the ability of agPNA–peptide conjugates to inhibit gene expression. When Ca2+ was present at 4 mM, it enabled 1 μM concentrations of PNA conjugate 4 (D–K8) or PNA conjugate 9 (L–R8) to inhibit PR expression at 94% and 93% respectively. These potencies are approximately 4–fold better than those achieved in the absence of calcium. Unfortunately, addition of Ca2+ often led to formation of a precipitate under a variety of media conditions and caused increased cell death, complicating its routine use as an additive for improving gene silencing.
FIGURE 5.
Western analysis of PR protein expression showing the effect of adding calcium chloride and PNA-peptide conjugates. Conjugates 4 (D-K8) or 9 (L-R8)and mismatch-containing conjugate 33 and 34 were tested in the presence of 0 - 4 mM CaCl2. PNA concentration was 1 μM. Percentages for inhibition are relative to the levels of PR expression measured after addtion of mismatch conjugates 33 or 34. ni: no significant (<10%) inhibition.
FIGURE 6.

Western analysis of PR protein expression showing the effect of adding 100 μM chloroquine on inhibition of PR protein expression by agPNAs. PNAs were present at 1 μM. Lane 1, PNA 1; Lane 2, conjugate 4 (D-K8); Lane 3, conjugate 9 (L-R8); Lane 4, conjugate 8 (TAT); Lane 5, conjugate 14 (R8F4); Lane 6, PNA 30 (D-AAKK)4 antisense; Lane 7, noncomplementary conjugate 36; Lane 8, mismatch-containing conjugate 34.
We also tested the effect of adding chloroquine (Figure 6), another agent noted for its ability to disrupt endosomes (21,22). We added chloroquine in combination with PNA–peptide conjugates and observed that only conjugate 14 (R8F4) yielded substantial inhibition when added at a concentration of 1 μM. Conjugates 4 (D-K8) and 9 (L-R8) that possessed IC50 values of 3-4 μM in the absence of chloroquine did not yield reduced PR expression when chloroquine was present. These data suggest that addition of chloroquine does not decisively enhance inhibition of gene expression by agPNAs that target PR. Moreover, as we had observed with Ca2+, addition of chloroquine reduced cell viability and made the assay less reproducible.
Inhibition of Gene Expression by agPNA–Peptide–Hydrophobic Group Conjugates
Previous reports have indicated that attachment of hydrophobic groups can improve cellular uptake and activity of oligonucleotides (37,38). Attachment of a palmitoyl chain to a thirteen base thiophosphoramidate oligomer that is complementary to human telomerase yields a conjugate that is substantially more active when added directly to cultured cells (37). This conjugate is now being tested in clinical trials. Attachment of a cholesterol moiety to duplex RNA improves gene silencing upon administration in mice (38). The mechanism by which hydrophobic groups improve cellular uptake is not clear, but increased hydrophobicity may alter interactions with membranes and release from endosomes.
To test the hypothesis that attachment of hydrophobic groups would improve the efficiency of antigene silencing, we synthesized PNA–peptide conjugates containing a variety of hydrophobic groups (Figure 7). We used serum–free (Figure 8 A and C) and 10% serum–containing media (Figure 8 B and D) because of the possibility that interactions between hydrophobic groups and serum proteins might affect the properties of the conjugates.
FIGURE 7.
Chemical structures of hydrophobic groups attached to PNAs
FIGURE 8.
Western analysis of PR protein expression by PNA-peptide-hydrophobic conjugates. (A) Transfection of cells in OptiMEM (serum-free) media with various PNA conjugates at 0.5 μM. Lane 1, Conjugate 21 (R8-C10); Lane 2, Conjugate 22 (R8-C15); Lane 3, Conjugate 23 (R8-C18); Lane 4, Conjugate 24 (K8-C18); Lane 5, Conjugate 27 (R8-cholyl); Lane 6, Conjugate 26 (R12C18); Lane 7, Conjugate 25 (R8H4-C18); Lane 8, Noncomplementary conjugate 37 (R8-C18); Lane 9 Mismatch-containing conjugate 35 (R8-C18). (B) Transfection of cells in RPMI media containing 10 % serum. The concentration of PNA conjugates is 1 μM. Lane 1, Conjugate 20 (PNA-C18, no peptide); Lane 2, Conjugate 24 (K8-C18); Lane 3, Conjugate 21 (R8-C10); Lane 4, Conjugate 22 (R8-C15); Lane 5, Conjugate 23 (R8-C18); Lane 6, Conjugate 28 (R8-linoleoyl ); Lane 7, Conjugate 29 (R8-cholesteryl); Lane 8, Conjugate 27 (R8-cholyl); Lane 9, Conjugate 26 (R12-C18); Lane 10, Conjugate 25 (R8H4-C18); Lane 11 Mismatch-containing conjugate 35 (R8-C18); (C) Inhibition of PR expression by increasing concentrations of conjugate 23 (R8-C18) in OptiMEM (serum-free); (D) Inhibition of PR expression by increasing concentrations of conjugate 23 in RPMI media with 10 % serum. Percentages for inhibition are relative to mismatch control PNA 35 (R8-C18) at the highest concentration used. ni: no significant (<10%) inhibition.
Several of these conjugates blocked PR expression when added to serum–free (Figure 8 A) at concentration of 0.5 μM or serum–containing (Figure 8 B) cell culture media at 1 μM. PNA 20 directly linked with a saturated C18 chain showed no inhibition of PR. PNA–peptide conjugates 23, 24, and 26 containing a C18 chain were effective regardless of whether the parent peptide contained lysine or arginine and in either type of media. Inhibition declined depending on the length of the carbon chain (C18>C15>C10). The IC50 values for inhibition of PR expression by conjugate 23 (R8–C18) in serum free (Figure 8 C) and serum containing (Figure 8 D) media were 0.5 and 1 μM respectively, several fold lower than that achieved by the analogous conjugate 9 lacking the C18 moiety. Conjugation of linoleoyl (conjugate 28), cholesteryl (conjugate 29), and cholyl (conjugate 27) groups had little or modest inhibition compared with conjugation with the saturated C18 chain. These data are significant because they suggest that attachment of hydrophobic moieties can lead to significant improvements in the efficiency of gene silencing.
Potency of PR inhibition in MCF–7 cells
Protein expression varies between cell lines and between different tissues. agPNAs target promoter DNA, and it is reasonable to hypothesize that the level of gene expression will affect access of the PNA to the promoter and the potency of the PNA as an inhibitor of gene expression. To begin investigating this possibility, we introduced agPNA–peptide conjugates into MCF–7 cells, a breast cancer–derived cell line that expresses PR at a much lower level than T47D cells (Figure 9 A). We observed substantial (>∼50 % at 6 μM PNA–peptide) inhibition of PR expression by PNA–peptide conjugates 30 (an antisense conjugate) (90 %), 14 (92 %), 11 (48 %), and 12 (70 %) (Figure 9 B).
FIGURE 9.

Western analysis of inhibition of PR protein expression by agPNA-peptide conjugates in MCF-7 breast cancer cells: (A) Western analysis of expression of PR levels in T47D and MCF-7 cells. No PNA was added to these cells. (B) Effect of adding PNA-peptide conjugates on expression of PR in MCF-7 cells. Lane 1, Conjugate 30 PNA (D-AAKK)4 antisense; Lane 2, Conjugate 4 (D-K8); Lane 3, Conjugate 9 (L-R8); Lane 4 Conjugate 14 (L-R8F4); Lane 5, Conjugate 11 (D-R8); Lane 6, Conjugate 12 (D-R12); Lane 7, Noncomplementary conjugate 36; Lane 8, Mismatch-containing conjugate 34 (L-R8). Percentages for inhibition are relative to levels of PR expression measured after addition of mismatch conjugate 34. All PNAs were present at 6 μM.
These data broaden the potential application of agPNAs by suggesting that they can be active in cells that express low levels of the target protein. Analogous agRNAs targeting the PR promoter in MCF-7 cells did not inhibit PR expression. The difference between agPNAs (potent inhibitors of PR expression in both MCF-7 and T47D cells) and agRNAs (potent inhibitors of PR expression in T47D cells but not inhibitory in MCF-7 cells) reinforce the conclusion that the mechanisms for inhibition of gene expression by promoter-targeted PNAs and RNAs differ significantly.
DISCUSSION
Designing Molecules that Recognize Chromosomal DNA
Chromosomal DNA presents a complex structural and functional landscape that challenges the development of synthetic antigene agents (5). At the most basic level, DNA consists of an almost infinite variety of different sequences. Some sequences code for RNA, others help control gene expression, while some have no known function. These DNA sequences bind a complex mix of histones and other proteins. The situation is further complicated by the fact that the state of chromatin changes during physiologic processes and development, suggesting that accessibility of a given sequence may vary from one cell line to another and depend on the environment of the cell. Finally, recent studies have revealed a network of noncoding RNA transcripts that may also have the potential to influence the environment around the chromosome (39,40).
Defining chromosomal landscapes inside cells would benefit from sensitive chemical probes capable of recognizing specific sequences. Such probes must be able to overcome multiple challenges including crossing the outer cell membrane, crossing the nuclear membrane, and binding to DNA. If all of these obstacles can be overcome, probes would be useful agents for i) defining the accessibility of sequences, ii) demonstrating their functional importance, and iii) manipulating gene expression.
PNAs as Probes for Chromosomal DNA
PNAs offer important advantages for recognizing chromosomal DNA. PNAs can recognize any sequence by Watson–Crick base–pairing and their neutral amide backbone confers a remarkable ability to invade duplex DNA (1-5). The non-natural amide backbone is unlikely to interact with proteins that have evolved to bind the phosphate backbone of DNA and RNA and, relative to duplex RNA or single-stranded phosphodiester oligonucleotides, PNAs will offer a much different potential for off-target effects and a much different perspective for research involving recognition of sequences within chromosomes.
PNAs present a distinct and powerful option for cellular assays and the advantages for PNAs are widely recognized. To be widely useful for antigene applications, however, methods for using agPNAs must be simple. Biologists will not use PNAs as a routine tool if cellular uptake of active PNAs is difficult to achieve. Cell transport peptides are an attractive strategy for improving cellular delivery of PNAs because protocols are simple. The PNA–peptide conjugates can be added directly to cells. There is no need for cationic lipid, electroporation, or other specialized manipulations that complicate protocols, perturb cells, and confuse observation of phenotypes.
agPNA–Peptide Conjugates Block Gene Expression
We observe that agPNA–peptide conjugates inhibit gene expression in cultured cells. Our data demonstrate that PNA conjugates can be added to cells using a simple protocol, enter the nucleus, and locate a sequence encoding by promoter DNA. Increasing the number of positive charges tends to enhance inhibition of gene expression, as does attachment of small molecule hydrophobic groups. The exact sequence of the cationic peptide has surprisingly little effect, with different combinations of lysine, arginine, and hydrophobic amino acids all producing active conjugates. These data suggest successful import of PNAs is not confined to a narrow range of compounds; rather a substantial diversity of chemical space is available.
Improving the Potency of agPNAs
While some conjugates were more potent than others, even the best conjugates possessed IC50 values of only 0.5 to 1 μM. This potency is 50–fold lower than those achieved by PNAs delivered by cationic lipid and 100–10,000 lower than those reported by experimenters using duplex siRNAs. Other reports describing antisense PNA–peptide conjugates to affect RNA splicing or block gene expression have noted the same limit on potency of 1 μM (14-20), suggesting that this ceiling is a general barrier to efficient silencing by PNA–cationic peptide conjugates.
Recent studies indicate that uptake of PNA–peptide conjugates is mediated by endocytosis. This is evident from microscopy of live cells that show a punctate distribution of fluorescently labeled PNA and studies that show co–localization of PNAs with endosomal markers (13,20-24). One solution, therefore, is to increase the amount of PNA released from endosomes. Other investigators have shown that additives like sucrose, calcium, and chloroquine can be used to improve the potency of PNAs (21,22), and we also observe this outcome. However, in our hands, these improvements are relatively small and addition of calcium and chloroquine reduced cell viability. It is possible that better protocols for additives can be developed or that some cell lines may be more suited for their use.
Another solution is discovery of chemical modifications that will facilitate cellular uptake of agPNA–peptide conjugates. To be widely useful for laboratory research or clinical development, modified conjugates must be straightforward to synthesize. Overly complex molecules will not be a solution, regardless of their efficacy. In our work we explored combining cationic peptides with small molecules and observed a significant improvement in potency. To date, we have explored only a handful of the vast number of potential modifications. Other simple modifications may yield more striking results but rationalizing their design and prioritizing their testing will be a challenge.
Conclusion
We have found that PNA–peptide conjugates can target chromosomal DNA and inhibit gene expression. Potency can be improved using conjugates that contain hydrophobic groups. These peptide conjugates are advantageous because they are easy to synthesize and simple to use with cultured cells. Potency can also be improved by adding agents that facilitate release from endosomes, but the improvement is modest and use of additives complicate the experimental protocol. Discovery of improved peptide import sequences or robust protocols for using additives are important goals for future research.
ACKNOWLEDGEMENTS
This work was supported by the National Institutes of Health (NIGMS 60642 and 73042), the Robert A. Welch Foundation (I–1244), and Applied Biosystems.
Footnotes
Abbreviations: PNA, peptide nucleic acid; agPNA, antigene PNA; PR, progesterone receptor
REFERENCES
- 1.Nielsen PG, Egholm M, Berg RH, Buchardt O. Sequence–selective recognition of DNA by strand displacement with a thymine–substituted polyamide. Science. 1991;254:1497–1500. doi: 10.1126/science.1962210. [DOI] [PubMed] [Google Scholar]
- 2.Bentin T, Nielsen PE. Enhanced peptide nucleic acid binding to supercoiled DNA: possible implications for DNA “breathing” dynamics. Biochemistry. 1996;35:8863–8869. doi: 10.1021/bi960436k. [DOI] [PubMed] [Google Scholar]
- 3.Smulevitch SV, Simmons CG, Norton JC, Wise TW, Corey DR. Enhanced strand invasion of oligonucleotides through manipulation of backbone charge. Nat. Biotech. 1996;14:1700–1705. doi: 10.1038/nbt1296-1700. [DOI] [PubMed] [Google Scholar]
- 4.Demidov VV, Broude NE, Lavrentieva–Smolina IV, Kuhn H, Frank–Kamenetskii MD. An artificial primosome: design, function, and applications. ChemBiochem. 2001;2:133–139. doi: 10.1002/1439-7633(20010202)2:2<133::AID-CBIC133>3.0.CO;2-L. [DOI] [PubMed] [Google Scholar]
- 5.Kaihatsu K, Janowski BA, Corey DR. Recognition of chromosomal DNA with PNAs. Chem. Biol. 2004;11:749–758. doi: 10.1016/j.chembiol.2003.09.014. [DOI] [PubMed] [Google Scholar]
- 6.Boffa LC, Scarfi S, Mariani MR, Damonte G, Allfrey VG, Benatti U, Morris PL. Dihydrotestosterone as a selective cellular/nuclear localization vector for anti–gene peptide nucleic acid in prostatic carcinoma cells. Cancer Res. 2000;60:2258–2262. [PubMed] [Google Scholar]
- 7.Cutrona G, Carpaneto EM, Ponzanelli A, Ulivi M, Millo E, Scarfi S, Roncella S, Benatti U, Boffa LC, Ferrarini M. Inhibition of the translocated c–myc in Burkitt's lymphoma by a PNA complementary to the E mu enhancer. Cancer Res. 2003;63:6144–6148. [PubMed] [Google Scholar]
- 8.Tyler BM, Jansen K, McCormick DJ, Douglas CL, Boules M, Stewart JA, Zhao L, Lacy B, Cusack B, Fauq A, Richelson E. Peptide nucleic acids targeted to the neurotensin receptor and administered i.p. cross the blood–brain barrier and specifically reduce gene expression. Proc. Natl. Acad. Sci. U S A. 1999;96:7053–8. doi: 10.1073/pnas.96.12.7053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Janowski BA, Kaihatsu K, Huffman KE, Schwartz JC, Ram R, Hardy D, Mendelson CR, Corey DR. Inhibiting transcription of chromosomal DNA with antigene peptide nucleic acids. Nat. Chem. Biol. 2005;1:210–215. doi: 10.1038/nchembio724. [DOI] [PubMed] [Google Scholar]
- 10.Janowski BA, Hu J, Corey DR. Silencing gene expression by targeting chromosomal DNA with antigene peptide nucleic acids and duplex RNAs. Nat. Protocols. 2006;1:436–443. doi: 10.1038/nprot.2006.64. [DOI] [PubMed] [Google Scholar]
- 11.Jarver P, Langel U. Cell penetrating peptides, a brief introduction. Biochimica et Biophysica Acta. 2006;1758:260–263. doi: 10.1016/j.bbamem.2006.02.012. [DOI] [PubMed] [Google Scholar]
- 12.Pooga M, Soomets U, Hallbrink M, Valkna A, Saar K, Rezaei K, Kahl U, Hao J–K, Xu X–J, Wiesenfeld–Hallin Z, Hokfelt T, Bartfai T, Langel U. Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo. Nat. Biotech. 1998;16:857–861. doi: 10.1038/nbt0998-857. [DOI] [PubMed] [Google Scholar]
- 13.Kaihatsu K, Huffman K,E, Corey DR. Intracellular uptake and inhibition of gene expression by PNAs and PNA–peptide conjugates. Biochemistry. 2004;43:14340–14347. doi: 10.1021/bi048519l. [DOI] [PubMed] [Google Scholar]
- 14.Cogoi S, Codognotto A, Rapozzi V, Meeuwenoord N, van der Marel G, Xodo LE. Transcription inhibition of oncogenic KRAS by a mutation–selective peptide nucleic acid conjugated to the PKKKRKV nuclear localization signal peptide. Biochemistry. 2005;44:10510–10519. doi: 10.1021/bi0505215. [DOI] [PubMed] [Google Scholar]
- 15.Turner JJ, Ivanova GD, Verbeure B, Williams D, Arzumanov AA, Abes S, Lebleu B, Gait MJ. Cell–penetrating peptide conjugates of peptide nucleic acids (PNA) as inhibitors of HIV–1 Tat–dependent trans–activation in cells. Nucl. Acids Res. 2005;33:6837–6849. doi: 10.1093/nar/gki991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Turner JJ, Jones S, Fabani MM, Ivanova G, Arzumanov AA, Gait MJ. RNA targeting with peptide conjugates of oligonucleotides, siRNAs, and PNAs. Blood Cells Mol. Dis. 2007;38:1–7. doi: 10.1016/j.bcmd.2006.10.003. [DOI] [PubMed] [Google Scholar]
- 17.Sazani P, Kang S–H, Maier MA, Wei C, Dillman J, Summerton J, Manoharan M, Kole R. Nuclear antisense effects of neutral, anionic, and cationic oligonucleotide analogs. Nucl. Acids Res. 2001;29:3965–3974. doi: 10.1093/nar/29.19.3965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sazani P, Gemignani, Kang S–H, Maier MA, Manoharan M, Persmark M, Bortner D, Kole R. Systemically delivered antisense oligomers upregulate gene expression in mouse tissues. Nat. Biotech. 2002;20:1228–1233. doi: 10.1038/nbt759. [DOI] [PubMed] [Google Scholar]
- 19.Albertshofer K, Siwkowski A, Wancewicz EV, Esau CC, Watanabe T, Nishihara KC, Kinberger GA, Malik L, Eldrup AB, Manoharan M, Geary RS, Monia BP, Swayze EE, Griffey RH, Bennett CF, Maier MA. Structure–activity relationship study on a simple cationic peptide motif for cellular delivery of antisense peptide nucleic acid. J. Med. Chem. 2005;48:6741–6749. doi: 10.1021/jm050490b. [DOI] [PubMed] [Google Scholar]
- 20.Maier MA, Esau CC, Siwkowski AM, Wancewicz EV, Albertshofer K, Kinberger GA, Kadaba NS, Watanabe T, Manoharan M, Bennett CF, Griffey RH, Swayze EE. Evaluation of basic amphipathic peptides for cellular delivery of antisense peptide nucleic acids. J. Med. Chem. 2006;49:2534–2542. doi: 10.1021/jm051275y. [DOI] [PubMed] [Google Scholar]
- 21.Shiraishi T, Pankratova S, Nielsen PE. Calcium ions effectively enhance the effect of antisense peptide nucleic acids conjugated to cationic tat and oligoarginine peptides. Chem. Biol. 2005;12:923–929. doi: 10.1016/j.chembiol.2005.06.009. [DOI] [PubMed] [Google Scholar]
- 22.Abes S, Williams D, Prevot P, Thierry A, Gait MJ, Lebleu B. Endosome trapping limits the efficiency of splicing correction by PNA–oligolysine conjugates. J. Cont. Release. 2006;110:595–604. doi: 10.1016/j.jconrel.2005.10.026. [DOI] [PubMed] [Google Scholar]
- 23.Bendifallah N, Winther Rasmussen F, Zachar V, Ebbesen P, Nielsen PE, Koppelhus U. Evaluation of Cell–Penetrating Peptides (CPPs) as vehicles for intracellular delivery of peptide nucleic acid (PNA) Bioconj. Chem. 2006;17:750–758. doi: 10.1021/bc050283q. [DOI] [PubMed] [Google Scholar]
- 24.Nielsen PE. Addressing the challenges of cellular delivery and bioavailability of peptide nucleic acids (PNA) Q. Rev. Biophys. 2006:1–6. doi: 10.1017/S0033583506004148. 2006. [DOI] [PubMed] [Google Scholar]
- 25.Mayfield LD, Corey DR. Automated synthesis of peptide nucleic acids and peptide nucleic acid conjugates. Anal. Biochem. 1999;268:401–404. doi: 10.1006/abio.1998.3052. [DOI] [PubMed] [Google Scholar]
- 26.Hussey SL, He E, Peterson BR, Synthesis of chimeric 7α–substituted estradiol derivatives linked to cholesterol and cholesterylamine. Org. Lett. 2002;4:415–418. doi: 10.1021/ol0171261. [DOI] [PubMed] [Google Scholar]
- 27.Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P. Two distinct estrogen regulated gene promoters generate transcripts encoding two functionally different human progesterone receptor forms A and B. EMBO J. 1990;9:1603–1614. doi: 10.1002/j.1460-2075.1990.tb08280.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Misrahi M, Venencie P–Y, Saugier–Veber P, Sar S, Dessen P, Milgrom E. Structure of the human progesterone receptor gene. Biochim. Biophys. Acta. 1993;1216:289–292. doi: 10.1016/0167-4781(93)90156-8. [DOI] [PubMed] [Google Scholar]
- 29.Janowski BA, Huffman KE, Schwartz JC, Ram R, Hardy D, Shames DS, Minna JD, Corey DR. Inhibiting gene expression at transcription start sites in chromosomal DNA by antigene RNAs. Nat. Chem. Biol. 2005;1:216–222. doi: 10.1038/nchembio725. [DOI] [PubMed] [Google Scholar]
- 30.Janowski BA, Huffman KE, Schwartz JC, Ram R, Nordsell R, Shames DS, Minna JD, Corey DR. Ago1 and Ago2 link mammalian transcriptional silencing with RNAi. Nat. Struct. Mol. Biol. 2006;13:787–792. doi: 10.1038/nsmb1140. [DOI] [PubMed] [Google Scholar]
- 31.Beane RL, Ram R, Monia, Gabillet S, Arar K, Monia BP, Corey DR. Inhibiting gene expression with locked nucleic acids (LNAs) that target chromosomal DNA. Biochemistry. 2007 doi: 10.1021/bi700227g. in Press. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hamilton SE, Iyer M, Norton JC, Corey DR. Specific and Nonspecific Inhibition of RNA Synthesis by DNA, PNA and Phosphorothioate Promoter Analog Duplexes. Bioorg. Med. Chem. Lett. 1996;6:2897–2900. [Google Scholar]
- 33.Thierry AR, Abes S, Resina S, Travo A, Richard JP, Prevot P, Lebleu B. Comparison of basic peptides– and lipid–based strategies for the delivery of splice correcting oligonucleotides. Biochim. Biophys. Acta. 2006;1758:364–374. doi: 10.1016/j.bbamem.2005.10.010. [DOI] [PubMed] [Google Scholar]
- 34.Brooks H, Lebleu B, Vives E. Tat peptide–mediated cellular delivery: back to basics. Adv. Drug Deliv. Rev. 2005;57:559–577. doi: 10.1016/j.addr.2004.12.001. [DOI] [PubMed] [Google Scholar]
- 35.Janowski BA, Younger ST, Hardy DB, Ram R, Huffman KE, Corey DR. Activating gene expression in mammalian cells with promoter-targeted duplex RNAs. Nat. Chem. Biol. 2007;3:166–173. doi: 10.1038/nchembio860. [DOI] [PubMed] [Google Scholar]
- 36.Kawamura KS, Sung M, Bolewska–Pedyczak E, Gariepy J. Probing the impact of valency on the routing of arginine–rich peptides into eukaryotic cells. Biochemistry. 2006;45:1116–1127. doi: 10.1021/bi051338e. [DOI] [PubMed] [Google Scholar]
- 37.Herbert BS, Gellert GC, Hochreiter A, Pongracz K, Wright WE, Zielinska D, Chin AC, Harley CB, Shay JW, Gryaznov SM. Lipid modification of GRN163, an N3′—>P5′ thio–phosphoramidate oligonucleotide, enhances the potency of telomerase inhibition. Oncogene. 2005;24:5262–5268. doi: 10.1038/sj.onc.1208760. [DOI] [PubMed] [Google Scholar]
- 38.Soutschek J, Akinc A, Bramlage B, Charisse K, Constien R, Donoghue M, Elbashir S, Geick A, Hadwiger P, Harborth J, John M, Kesavan V, Lavine G, Pandey RK, Racie T, Rajeev KG, Rohl I, Toudjarska I, Wang G, Wuschko S, Bumcrot D, Koteliansky V, Limmer S, Manoharan M, Vornlocher HP. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature. 2004;432:173–178. doi: 10.1038/nature03121. [DOI] [PubMed] [Google Scholar]
- 39.Chen J, Sun M, Kent WJ, Huang X, Xie H, Wang W, Zhou G, Zhang R, Rowley JD. Over 20 % of human transcripts might form sense-antisense pairs. Nucl. Acids. Res. 2004;32:4812–4820. doi: 10.1093/nar/gkh818. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wahlstedt C. Natural sense and noncoding RNA transcripts as potential drug targets. Drug Discovery Today. 2006;11:503–508. doi: 10.1016/j.drudis.2006.04.013. [DOI] [PubMed] [Google Scholar]




