TABLE 1.
Absolute quantitative RT–PCR (qRT–PCR) analysis of MoDcl1 and MoDcl2 in the overexpressing transformants and wild type of Magnaporthe oryzae
| mRNA copies (per 25 ng total RNA)
|
Relative fold to wild type
|
|||
|---|---|---|---|---|
| Strain | MoDcl1 | MoDcl2 | MoDcl1 | MoDcl2 |
| Wild type (Br48) | 689.1 ± 97.8a | 9,267.7 ± 935.8 | 1 | 1 |
| tMoDcl1-OE11 | 248,853.2 ± 15,017.6 | NE | 361.2 | |
| tMoDcl1-OE12 | 154,310.5 ± 8,766.6 | NE | 223.9 | |
| tMoDcl1-OE13 | 224,692.2 ± 3,004.1 | NE | 326.1 | |
| tMoDcl2-OE21 | NE | 24,372.4 ± 1,662.2 | 2.6 | |
| tMoDcl2-OE22 | NE | 252,251.5 ± 19,721.7 | 27.2 | |
| tMoDcl2-OE23 | NE | 13,400.5 ± 1,140.8 | 1.4 | |
Quantitative RT–PCR (qRT–PCR) analysis was performed with real-time PCR (Applied Biosystems 7500 or 7300 real-time PCR system) and SYBR Green fluorescence detection (SYBR GreenER two-step qRT–PCR kit for universal; Applied Biosystems, Foster City, CA). Total RNA was extracted from fungal mycelia grown in liquid media as described previously (Kadotani et al. 2004), and reverse transcribed into cDNAs using a SuperScript III RT–PCR system (Invitrogen). Sets of specific primers for MoDcl1 (MDL1-Fw: CCCGTGGATACTGTGGTAATGG, MDL1-Rv: GCAATGTCGATTGGAATATCAAGAC) and MoDcl2 (MDL2-Fw: CGCTCTACTTCCAGTCCCTTTC, MDL2-Rv: TGGTCACGTCTGGATCAAAGC) as well as for two internal controls, actin (Mo-actin-F: GCGGTTACACCTTCTCTACCAC, Mo-actin-R: AGTCTGGATCTCCTGCTCAAAG), and β-tubulin genes (Mo-tub-F: CGAGACCTTCTGCATTGACAAC, Mo-tub-R: GGCCGAAACCAGGTAGTTCA), were used in the analysis. The copy numbers of the MoDcl1 and MoDcl2 transcripts relative to the total RNA were determined by real-time RT–PCR with reference to standard plasmids carrying MoDcl1 and MoDcl2 cDNAs, respectively. NE, not examined.
Standard deviation.