Table 2.
Name | Nucleotide sequence | Base positionsa |
---|---|---|
alcA-EcoRI | GGCCgaattcAGACATTGCAAGCCCCTGATb | 2597374..2597393 |
alcA-SalI | GGCCgtcgacGTCCGATACCGATAGCCACGAA | 2597813..2597792 |
bfeA-EcoRI | GGCCgaattcGCGCAGGCCGGGCTTGAGTTC | 3076704..3076724 |
bfeA-SalI | GGCCgtcgacGGGGGTGGACATGCGGCTTCT | 3077139..3077119 |
bhuR-EcoRI | GGCCgaattcCGCCGACAACCGCACCCACTC | 351402..351382 |
bhuR-SalI | GGCCgtcgacGCCCTGATCGCAAGCGTAAACCAT | 350898..350921 |
BP0771c | CCGCCCGCGCCGTAGTTCACCAC | 792956..792978 |
3110junc | CGCGGACCACAGCCCCATCACCAG | NAd |
Nucleotide coordinates of the B. pertussis Tohama I genome sequence (The Wellcome Trust Sanger Institute, ftp://ftp.sanger.ac.uk/pub/pathogens/bp/).
Nucleotides in lower case represent restriction enzyme recognition site adapters incorporated for cloning to pSS3110-TnpR. Underlined nucleotides are complementary to B. pertussis chromosomal DNA sequences.
complementary to the B. pertussis chromosomal site of pSS3110-TnpR integration
Not applicable, primer is complementary to the pSS3110-TnpR plasmid vector