Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of 4 miRNAs
| Accession Number | Gene length (bp) | Pre-miRNA length (bp) | Hit-miRNA | miRNA seq | Chromosome |
|---|---|---|---|---|---|
| CU406292 | 1416 | 262 (220–490) | osa-MIR159a | uuuggauugaagggagcucug | 01 |
| CU405943 | 1511 | 101 (160–280) | osa-MIR156j | ugacagaagagagugagcac | 06 |
| CU861819 | 561 | 80 (390–470) | osa-miR818e | aaucccuuauauuuugggacgg | 04 |
| CU861752 | 727 | 150 (325–475) | osa-miR446 | aucaauaugaaugugggaaau | 10 |
