Skip to main content
BMC Molecular Biology logoLink to BMC Molecular Biology
. 2008 Oct 1;9:83. doi: 10.1186/1471-2199-9-83

Identification and characterization of CCAAT/Enhancer Binding proteindelta (C/EBPdelta) target genes in G0 growth arrested mammary epithelial cells

Yingjie Zhang 1, Tong Liu 1, Pearlly Yan 2, Tim Huang 2,3, Jim DeWille 1,3,
PMCID: PMC2576343  PMID: 18828910

Abstract

Background

CCAAT/Enhancer Binding Proteinδ (C/EBPδ) is a member of the highly conserved C/EBP family of leucine zipper (bZIP) proteins. C/EBPδ is highly expressed in G0 growth arrested mammary epithelial cells (MECs) and "loss of function" alterations in C/EBPδ have been associated with impaired contact inhibition, increased genomic instability and increased cell migration. Reduced C/EBPδ expression has also been reported in breast cancer and acute myeloid leukemia (AML). C/EBPδ functions as a transcriptional activator, however, only a limited number of C/EBPδ target genes have been reported. As a result, the role of C/EBPδ in growth control and the potential mechanisms by which "loss of function" alterations in C/EBPδ contribute to tumorigenesis are poorly understood. The goals of the present study were to identify C/EBPδ target genes using Chromatin Immunoprecipitation coupled with a CpG Island (HCG12K) Array gene chip ("ChIP-chip") assay and to assess the expression and potential functional roles of C/EBPδ target genes in growth control.

Results

ChIP-chip assays identified ~100 C/EBPδ target gene loci which were classified by gene ontology (GO) into cell adhesion, cell cycle regulation, apoptosis, signal transduction, intermediary metabolism, gene transcription, DNA repair and solute transport categories. Conventional ChIP assays validated the ChIP-chip results and demonstrated that 14/14 C/EBPδ target loci were bound by C/EBPδ in G0 growth arrested MCF-12A MECs. Gene-specific RT-PCR analysis also demonstrated C/EBPδ-inducible expression of 14/14 C/EBPδ target genes in G0 growth arrested MCF-12A MECs. Finally, expression of endogenous C/EBPδ and selected C/EBPδ target genes was also demonstrated in contact-inhibited G0 growth arrested nontransformed human MCF-10A MECs and in mouse HC11 MECs. The results demonstrate consistent activation and downstream function of C/EBPδ in growth arrested human and murine MECs.

Conclusion

C/EBPδ target genes were identified by a global gene array approach and classified into functional categories that are consistent with biological contexts in which C/EBPδ is induced, such as contact-mediated G0 growth arrest, apoptosis, metabolism and inflammation. The identification and validation of C/EBPδ target genes provides new insights into the mechanistic role of C/EBPδ in mammary epithelial cell biology and sheds new light on the potential impact of "loss of function" alterations in C/EBPδ in tumorigenesis.

Background

CCAAT/Enhancer Binding Proteinδ (C/EBPδ) is a member of the highly conserved C/EBP family of leucine zipper DNA binding proteins [1-3]. Evidence accumulated since their discovery in the late 1980's indicates C/EBP function in the transcriptional control of genes that function in cell growth, survival, differentiation, inflammation and apoptosis [1-3]. C/EBPδ gene expression is increased in human and mouse mammary epithelial cells in response to growth arrest induction by serum and growth factor withdrawal, contact inhibition and IL-6 family cytokine treatment [4-11]. Ectopic C/EBPδ expression induces growth arrest of mouse mammary epithelial and human chronic myelogenous leukemia cell lines [5,12]. Conversely, reducing C/EBPδ gene expression is associated with delayed growth arrest, genomic instability, impaired contact inhibition, increased cell migration and reduced serum dependence [5,13]. Consistent with a role as a candidate tumor suppressor gene, "loss of function" alterations in C/EBPδ gene expression have been reported in primary human breast cancer and acute myeloid leukemia (AML) [11,14-18]. In vivo experimental studies indicate that C/EBPδ plays a complex role in mammary epithelial cell fate determining programs as C/EBPδ is transiently induced in the mammary gland during the early "reversible" phase of mammary gland involution and C/EBPδ knockout female mice exhibit mammary gland ductal hyperplasia [19-22].

Studies focusing on the regulation of C/EBPδ have reported that C/EBPδ is regulated at the transcriptional, post-transcriptional and post-translational levels [6,23-25]. These findings demonstrate that the content and function of C/EBPδ is tightly controlled at multiple levels. The goal of the present study was to gain new insights into the functional role of C/EBPδ in mammary epithelial cell growth arrest by identifying C/EBPδ downstream target genes using a global gene array approach. The results identified candidate C/EBPδ target genes that were classified by gene ontology (GO) and functional annotation clustering into DNA binding, transcriptional regulation, cell adhesion, cell cycle regulation, apoptosis, signal transduction, intermediary metabolism, DNA repair and transport. These findings provide new insights into the broad range of functions impacted by C/EBPδ in mammary epithelial cell biology and suggest new mechanisms by which alterations in C/EBPδ could contribute to defects in growth control, differentiation and tumorigenesis.

Results

C/EBPδ is induced in growth arrested human mammary epithelial cells

To identify C/EBPδ target genes we used the ChIP-chip assay, a technique that couples chromatin immunoprecipitation (ChIP) with (CpG) Island (CGI) microarray chip hybridization [26,27]. In the initial experiment, we validated the increase in C/EBPδ protein levels in MCF-12A human mammary epithelial cells growth arrested by contact inhibition for 24, 48 and 72 hours (Fig. 1a). We next transfected MCF-12A human mammary epithelial cells with a C/EBPδ-v5 fusion construct and demonstrated that the C/EBPδ-v5 protein was present at 24, 48 and 72 hours in contact inhibited MCF-12A cells, paralleling the results from experiments with endogenous C/EBPδ protein levels (Fig. 1b and Fig. 1a). Because available commercial and laboratory produced anti-C/EBPδ antibodies were not suitable for chromatin immunoprecipitation reactions the ChIP-chip assays were performed in contact-inhibited MCF-12A cells transfected with the C/EBPδ-v5 construct and the antibody interaction step was performed with a high affinity anti-v5 antibody. A schematic overview of the ChIP-chip protocol and representative microarray data images are presented (Fig. 1cd).

Figure 1.

Figure 1

C/EBPδ expression and C/EBPδ genomic target gene identification by ChIP-chip assay in MCF-12A cells. a. C/EBPδ protein levels in whole cell lysates from growing and confluent, contact-inhibited MCF-12A cells. Lanes: (1) Exponentially growing; (2) Confluence (contact inhibition) induced growth arrest (24 hours); (3) 48 hours; (4) 72 hours. b. C/EBPδ-v5 protein levels in transfected MCF-12A cells. Lanes: (1) MCF-12A cells transfected with pcDNA3 vector (CON, control), (2) Confluent 24 hours, (3) Confluent 48 hour, (4) Confluent 72 hours. c. Schematic overview of the ChIP-chip protocol. d. HCG12K Array probed with ChIP isolated DNA coupled with Alexa 555 or Alexa 647 dyes. The data presented were derived from dye swapping experiments performed on the same microarray.

Identification of and functional categories of C/EBPδ target genes

ChIP-chip results identified 289 candidate genomic regions from the UNH HCG12K array using a 2 fold enrichment threshold (C/EBPδ-v5 vs IgG control). Of these 289 genomic regions, 99 were identified in defined gene promoter regions (Table 1). C/EBPδ target genes are located on all human chromosomes, suggesting a broad and relatively unbiased distribution across the human genome (Fig. 2a). C/EBPδ target genes were identified and assigned to functional categories (Functional Annotation Clustering) using the Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resource. C/EBPδ target gene functional categories include: signal transduction, metabolism, transcriptional regulation, cell adhesion, DNA binding, cell cycle control, apoptosis, and solute/metabolite transport (Fig 2b).

Table 1.

C/EBPδ Target gene functional categories

Signal transduction
Gene Name Gene Description Gene ID

 ADM Adrenomedullin 133

 BAI3 brain-specific angiogenesis inhibitor 3 577

 DTNA dystrobrevin, alpha 1837

 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1857

 EDG1 endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 1901

 GNG10 guanine nucleotide binding protein (G protein), gamma 10 2790

 IRAK2 interleukin-1 receptor-associated kinase 2 3656

 LOX lysyl oxidase 4015

 NPAS1 neuronal PAS domain protein 1 4861

 CCL25 chemokine (C-C motif) ligand 25 6370

 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 8476

 INTS6 integrator complex subunit 6 26512

 GTPBP2 GTP binding protein 2 54676

 EPS15L2 epidermal growth factor receptor pathway substrate 15-like 2 55380

 VAC14 Vac14 homolog (S. cerevisiae) 55697

 ERBB2IP erbb2 interacting protein 55914

 ROBO3 roundabout, axon guidance receptor, homolog 3 (Drosophila) 64221

 C9orf89 chromosome 9 open reading frame 89 84270

 SPSB3 splA/ryanodine receptor domain and SOCS box containing 3 90864

 HSP90AA1 heat shock protein 90 kDa alpha (cytosolic), class A member 1 3320

 FGF9 fibroblast growth factor 9 (glia-activating factor) 2254

 SCAP2 src family associated phosphoprotein 2 8935

 GPR160 G protein-coupled receptor 160 26996

 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 7421

Metabolism

 OXA1L oxidase (cytochrome c) assembly 1-like 5018

 RPP30 ribonuclease P/MRP 30 kDa subunit 10556

 THBS4 thrombospondin 4 7060

 CKAP1 cytoskeleton associated protein 1 1155

 DLD dihydrolipoamide dehydrogenase 1738

 ESD esterase D/formylglutathione hydrolase 2098

 LRP1 low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) 4035

 PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 5689

 RPL29 ribosomal protein L29 6159

 MTMR6 myotubularin related protein 6 9107

 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 11096

 GCAT lycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) 23464

 ADAT1 adenosine deaminase, tRNA-specific 1 23536

 FLRT2 fibronectin leucine rich transmembrane protein 2 23768

 MRPL35 mitochondrial ribosomal protein L35 51318

 OTUB1 OTU domain, ubiquitin aldehyde binding 1 55611

 USP48 ubiquitin specific peptidase 48 84196

 ACBD5 acyl-Coenzyme A binding domain containing 5 91452

 C9orf103 chromosome 9 open reading frame 103 414328

 GANC glucosidase, alpha; neutral C 2595

 BCAT2 branched chain aminotransferase 2, mitochondrial 587

 CRLF3 cytokine receptor-like factor 3 51379

 ADPRH ADP-ribosylarginine hydrolase 141

Transcriptional regulation

 KLF6 Kruppel-like factor 6 1316

 DBP D site of albumin promoter (albumin D-box) binding protein 1628

 FLI1 Friend leukemia virus integration 1 2313

 MEF2B MADS box transcription enhancer factor 2, polypeptide B 4207

 POLR2F polymerase (RNA) II (DNA directed) polypeptide F 5435

 POU2F1 POU domain, class 2, transcription factor 1 5451

 SOX4 SRY (sex determining region Y)-box 4 6659

 TBP TATA box binding protein 6908

 ZNF20 zinc finger protein 20 7568

 CSDA cold shock domain protein A 8531

 RFXANK regulatory factor X-associated ankyrin-containing protein 8625

 TAF1A TATA box binding protein (TBP)-associated factor, RNA polymerase I, A 9015

 SSBP2 single-stranded DNA binding protein 2 23635

 MKL2 MKL/myocardin-like 2 57496

 TGIF2 TGFB-induced factor 2 (TALE family homeobox) 60436

 IRX6 iroquois homeobox protein 6 79190

 ESX1 extraembryonic, spermatogenesis, homeobox 1 homolog (mouse) 80712

 ZNF573 zinc finger protein 573 126231

 ALX4 aristaless-like homeobox 4 60529

Transporters

 KCND2 potassium voltage-gated channel, Shal-related subfamily, member 2 3751

 PCM1 pericentriolar material 1 5108

 TUSC3 tumor suppressor candidate 3 7991

 SLC25A14 solute carrier family 25 (mitochondrial carrier, brain), member 14 9016

 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 9146

 HCN4 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 10021

 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 30061

 MCART1 mitochondrial carrier triple repeat 1 92014

 CCBE1 collagen and calcium binding EGF domains 1 147372

Cell cycle regulation

 SEPT7 septin 7 989

 RCC1 regulator of chromosome condensation 1 1104

 PAPD5 PAP associated domain containing 5 64282

 DIRAS3 DIRAS family, GTP-binding RAS-like 3 9077

DNA binding

 TOP2B topoisomerase (DNA) II beta 180 kDa 7155

 HIST1H4F histone 1, H4f 8361

 KCMF1 potassium channel modulatory factor 1 56888

 XPC xeroderma pigmentosum, complementation group C 7508

 MSH5 mutS homolog 5 (E. coli) 4439

Cell Adhesion

 GP5 glycoprotein V (platelet) 2814

 ITGB8 integrin, beta 8 3696

 PCDH9 Protocadherin 9 5101

 RSHL1 radial spokehead-like 1 81492

 THBS4 thrombospondin 4 7060

Apoptosis

 TIA1 cytotoxic granule-associated RNA binding protein 7072

 BCL2L1 BCL2-like 1 598

 RNF34 ring finger protein 34 80196

Miscellaneous

 HSPCA heat shock protein 90 kDa alpha (cytosolic), class A member 1 3320

 OTOF otoferlin 9381

 LOH12CR1 loss of heterozygosity, 12, chromosomal region 1 118426

 MYEOV2 myeloma overexpressed 2 150678

 TMEM87A transmembrane protein 87A 25963

 MTPN myotrophin 136319

 DISC1 disrupted in schizophrenia 1 27185

Figure 2.

Figure 2

Chromosomal localization and functional categories of C/EBPδ target genes. A. Chromosomal localization of C/EBPδ-v5 bound candidate genomic targets identified by the C/EBPδ-v5 ChIP-chip assays using the UNH HCG12K array. b. C/EBPδ target genes were verified in authentic gene promoter regions and assigned to Functional Categories using the Database for Annotation, Visualization and Integrated Discovery (DAVID). The list of genes assigned to each category is presented in Table 1.

Chromatin immunoprecipitation (ChIP) and RT-analysis of C/EBPδ target genes

We next used conventional chromatin immunoprecipitation (ChIP) assays to confirm the interaction between C/EBPδ and selected candidate gene promoters in MCF-12A mammary epithelial cells. MCF-12A cells were transfected with the C/EBPδ-v5 construct, growth arrested by contact inhibition and conventional ChIP assays performed on 14 C/EBPδ candidate genes from diverse functional categories with proximal promoters containing at least one consensus C/EBP binding site (Fig. 3a). ChIP assay results were positive for 14/14 C/EBPδ candidate target gene promoters tested, although the degree of positive detection varied across the 14 target genes (Fig. 3b).

Figure 3.

Figure 3

Conventional ChIP and RT-PCR analysis of selected C/EBPδ ChIP-chip target genes. a. C/EBPδ ChIP-chip target gene promoters. C/EBPδ target gene promoters are shown with gene-specific primers (→) and computer predicted C/EBP consensus sites (▶) Gene-specific human primer pairs are presented in Table 2. b. Conventional ChIP assays. Whole cell lysates were isolated from MCF-12A cells transfected with pCDNA3.1-hC/EBPδ-v5 and growth arrested by contact inhibition. Conventional ChIP assays performed with anti-v5 and IgG (negative control) antibodies. Input lane is derived from direct PCR amplification of genomic DNA. c. C/EBPδ target gene expression: RT-PCR analysis. Total RNA was isolated from MCF-12A cells transfected with pCDNA3.1-hC/EBPδ-v5 and cultured under exponentially growing (GR) or contact inhibition conditions. Total RNA was reverse transcribed and PCR amplified using gene-specific primers. No RT = PCR amplification of RNA samples without RT. GAPDH was used as a non-C/EBPδ inducible RNA expression control.

ChIP-chip and direct ChIP assays address in situ protein/DNA binding but do not determine if DNA binding results in increased expression of the downstream target gene. To investigate the relationship between C/EBPδ promoter binding and C/EBPδ target gene expression MCF-12A cells were transfected with the C/EBPδ-v5 construct, growth arrested by contact inhibition and total RNA isolated for RT-PCR analysis. The RT-PCR results demonstrated that mRNA levels of 14/14 of the selected C/EBPδ target genes are significantly induced in MCF-12A cells transiently transfected with the C/EBPδ-v5 construct under contact inhibition, growth arrest conditions (Fig. 3c). The degree of C/EBPδ target gene expression as assessed by mRNA content was variable, possibly reflecting the complex nature of individual target gene transcriptional activation as well as individual target gene mRNA stability. Taken together, the conventional ChIP and RT-PCR results verified that the ChIP-chip assays identified authentic C/EBPδ target genes.

C/EBPδ and C/EBPδ target genes are induced in confluent (contact inhibited) human and mouse mammary epithelial cell lines

In previous work we reported that C/EBPδ expression is highly induced in growth arrested and IL-6 cytokine treated primary human mammary epithelial cells, MCF-12A and MCF-10A mammary epithelial cell lines [9]. To extend these findings in the current study we assessed the expression of C/EBPδ and selected C/EBPδ target genes in 48 hour confluent, G0 growth arrested MCF-10A mammary epithelial cells. The results demonstrated that G0 growth arrest was associated with an approximately 10-fold induction of C/EBPδ mRNA compared to exponentially growing MCF-10A cells (Fig. 4). Consistent with the growth arrest induction of C/EBPδ, the mRNA levels of selected C/EBPδ target genes were also induced, with fold induction of C/EBPδ target genes varying from ~.5–12 fold induction (Fig. 4).

Figure 4.

Figure 4

C/EBPδ and C/EBPδ target gene mRNA levels are expressed in confluent, G0 growth arrested human mammary epithelial cells. Growing MCF-10A cells were maintained at ~50% confluence in CGM; confluent MCF-10A cells were grown to confluence and maintained in CGM for 48 hours. Real Time PCR analysis was performed using the LightCycler 480 Real Time PCR System. The gene specific human primers pairs are presented in Table 3.

Table 3.

C/EBPδ and C/EBPδ target gene primers (mouse)

Sequence (5'-3') Length (bp)a Accession No.b
C/EBPδ FW CGACTTCAGCGCCTACATTGA 171 bp NM007679

RV CTAGCGACAGACCCCACAC

ASAHL FW GTCCTCCTGACTTCCTGG 225 bp NM025972

RV CCTGCCACTAAGCCTCAC

BCAT2 FW ATGAAGGCAAGCAACTCC 227 bp NM009737

RV TGGACAGACCTTTCCCTATT

GP5 FW CGCCAGCCTGTCGTTCT 185 bp NM008148

RV GCCTGTTATTGGGACTTTCAC

ITGB8 FW TTCTCCTGTCCCTATCTCCA 302 bp NM177290

RV TGAGACAGAT TGTGAGGGTG

MKL2 FW CTGTGGTCGTCAAGCAAGA 398 bp NM153588

RV TGTGTTTGGTGCCGAGTTT

MSH5 FW CGACTCCTGAGCCACATC 295 bp NM013600

RV TGGCATCTATGTCAGGGTC

OXA1L FW CGGTTCTATTGCCGTTGG 225 bp NM026936

RV CACCCACTCCTCTTTCCTTT

PCDH9 FW ACAGCCACCACGGTCCTCTA 219 bp NM001081377

RV CCCTTGTTGTTCCCGCTCAC

SCAP2 FW AGTGAAGATGGACGAGCAA 199 bp NM018773

RV TCCTACCCACCAGCCATA

T1A1 FW GAGAAGGGCTATTCGTTTG 208 bp NM009383

RV GTCCATACTGTTGTGGGTTT

VDR FW CAACGCTATGACCTGTGAA 299 bp NM009504

RV GCAGGATGGCGATAATGT

XPC FW TCCTGGGAGATACCTTCG 337 bp NM009531

RV AAAGAGCAGCAGGCAGTA

GAPDH FW CTCACTGGCATGGCCTTCCG 293 bp XM001473623

RV ACCACCCTGTTGCTGTAGCC

Note. FW: forward primer; RV: reverse primer.

aAmplicon length in base pairs.

bGenbank accession number of corresponding gene, availabe at http://www.ncbi.nlm.nih.gov

To extend the current results to mouse MECs we compared C/EBPδ and selected C/EBPδ target gene mRNA levels in growing and contact-inhibited, G0 growth arrested HC11 cells, a nontransformed mouse mammary epithelial cell line. The results confirmed the growth arrest induction of C/EBPδ and demonstrated parallel induction of selected C/EBPδ target gene mRNAs (Fig. 5a). The growth arrest inducible induction of C/EBPδ was dramatic (~90 fold), the growth arrest induction of selected C/EBPδ target genes varied from ~3–50 fold (Fig. 5). These results extend the association between C/EBPδ and the expression of C/EBPδ target genes to include both human and mouse derived nontransformed mammary epithelial cell lines.

Figure 5.

Figure 5

C/EBPδ and C/EBPδ target gene mRNA levels are increased in confluent, G0 growth arrested mouse mammary epithelial cells. Growing HC11 cells were maintained at ~50% confluence in CGM; confluent HC11 cells were grown to confluence and maintained in CGM for 48 hours. Real Time PCR analysis was performed using the LightCycler 480 Real Time PCR System. The gene specific primers are presented in Table 3. Real Time PCR data is normalized to the GAPDH control.

Discussion

This study identified C/EBPδ target genes using a "ChIP-chip" global gene array approach. The functional categories of a significant number of the C/EBPδ target genes are consistent with known biological responses associated with C/EBPδ expression and function. A significant number of studies have demonstrated that C/EBPδ gene expression is induced in contact-inhibited cells and the "ChIP-chip" analyses performed in this study identified C/EBPδ target genes that function in cell adhesion, a key aspect contact inhibition mediated growth arrest including, IGTB8, LOX, PCDH9, THBS4, and RSHL1 (Table 1) [28]. C/EBPδ induction of IGTB8 (Integrin B8) may be particularly relevant in breast cancer as IGTB8 inhibits epithelial cell growth by activating TGF-β [29,30]. In addition, LOX (lysyl oxidase), a cell-associated enzyme that functions in extracellular matrix biology has been identified as a tumor suppressor gene in gastric cancer [31]. However, the role of LOX is cancer biology is complex as LOX has also been shown to enhance breast cancer cell migration [32].

Additional C/EBPδ target genes function in the regulation of growth factor signaling, tumor suppression and transcription including: ERBB2IP, IRAK2, EDG1, INTS6, SCAP2, VDR, KLF6, MKL2, FLI1, TUSC3 and SOX4 (Table 1). ERBB2IP (Erbin) inhibits growth factor signaling by disrupting Sur-8/Ras/Raf complex formation interaction [33]. INTS6 (DICE1), a DEAD box protein that exhibits tumor suppressor activity, is hypermethylated and downregulated in prostate cancer [34]. VDR (vitamin D receptor), a member of the steroid hormone nuclear receptor superfamily, functions in calcium and noncalcium related cellular responses to vitamin D [35]. It is of interest that the VDR is required for vitamin D-induced growth arrest of breast and prostate derived cell lines and C/EBPδ is required for vitamin D-induced growth arrest of human breast (MCF-7) and prostate (LnCAP) cells [36,37]. These results indicate that C/EBPδ target genes play key roles in growth inhibitor signaling, cell-cell and cell matrix interactions and transcriptional regulation.

The C/EBPδ ChIP-chip results also identified three genes (BCL2L1, TIA-1, RNF34) that function in apoptosis. Reports from our lab and others demonstrate that C/EBPδ is expressed at the onset of mouse mammary gland involution [20,21,38]. It is of interest that BCL2L1 (bcl-x), a gene associated with pro- and anti-apoptotic functions was identified as a C/EBPδ target gene by the ChIP-chip assay. The primary BCL2L1 transcript can be alternatively spliced into two variants that encode proteins with opposing functions: Bcl-xL (anti-apoptotic) and Bcl-xS (pro-apoptotic) [39,40]. Bcl-xL is the most abundant Bcl-2 family member expressed in mammary epithelial cells and conditional deletion of the bcl-x gene from the mouse mammary epithelium enhances apoptosis during the initial phase of mammary gland involution [41]. Interestingly, Bcl-xS levels increase during mammary gland involution, resulting in a decrease in the Bcl-xL/Bcl-xS ratio in the involuting mammary gland [42]. A second apoptosis-related C/EBPδ target gene identified was TIA-1, an RNA binding protein that exhibits both pro- and anti-apoptotic activity [43,44]. These results suggest that C/EBPδ may function in the transcriptional control of BCL2L1 and TIA-1 but the pro- or anti-apoptotic functions are determined by posttranscriptional events. The third apoptosis-related C/EBPδ target gene identified in study is RNF34, an anti-apoptotic protein that is associated with activation of nuclear factor-κB (NF-κB) and increased levels of Bcl-xL [45]. In addition to the identification of growth control/tumor suppressor genes, the C/EBPδ ChIP-chip analysis identified eight inflammation related genes, including ADM, IRAK2, CCL25, OTUB1, KLF6, DBP, RFXANK and GP5 (Table 1). These findings are consistent with a well-established functional role of C/EBPδ in the acute phase response, inflammation and wound healing [23,46,47].

The ChIP-chip analysis also identified C/EBPδ target genes that encode proteins that function in general energy metabolism, including lipid metabolism, metabolite transport and mitochondrial energy-related functions (Table 1). These results are consistent with early reports documenting the key role of C/EBPδ in the 3T3-L1 fibroblast → adipocyte differentiation program [48,49].

The ChIP-chip analysis also identified a significant number of C/EBPδ target genes that function as transcriptional regulatory proteins. These results suggest that C/EBPδ initiates a biological response that is amplified by C/EBPδ target genes that also function as transcriptional regulatory proteins. Five C/EBPδ target genes are classified as homeobox genes (POU2F1, TGIF2, IRX6, ESX1L and ALX4) (Table 1). The potential role of C/EBPδ in the expression of homeobox genes suggests that C/EBPδ may influence cell fate or cell lineage determination. It has recently been shown that C/EBPδ inhibits growth and promotes self renewal of human limbic stem cells, suggesting a potential role for C/EBPδ in the maintenance of stem cell pluripotency [50]. These results suggest that C/EBPδ may play a previously unrecognized regulatory role in cell lineage determination in the mammary gland or possibly in mammary gland stem cell populations.

The ChIP-chip results identified C/EBPδ target genes that function specifically in neuronal differentiation and development (FGF9, MTPN, ROBO3, NPAS1, and DVL3) (Table 1). Early studies in our laboratory found that mouse brain expresses relatively high levels of C/EBPδ mRNA compared to other C/EBP family members [51]. In addition, the initial report that described the phenotype of C/EBPδ -/- mice reported selectively enhanced contextual fear conditioning, suggesting a role for C/EBPδ in learning or memory [52]. It is of interest that DTNA, a gene that functions in neuromuscular synaptic transmission was also identified as a C/EBPδ target gene and that C/EBPδ target genes were identified that function in differentiation and development of muscle cells and pattern formation of limb buds including MKL2, MEF2B and ALX4 [53]. These results suggest that epithelial cells may express a subset of genes that retain residual neural related or neuromuscular-related functions.

Conclusion

This is the first report to utilize the ChIP-chip assay to identify C/EBPδ target genes. The new C/EBPδ target genes identified by the ChIP-chip analysis are associated with biological responses previously associated with C/EBPδ expression, such as growth arrest, cell adhesion, inflammation, energy metabolism and apoptosis. Gene expression analyses performed in human and mouse mammary epithelial cell lines confirm the link between the expression of C/EBPδ, C/EBδ target genes and the G0 growth arrest state. These results provide new insights into the functional role of C/EBPδ and C/EBPδ target genes in mammary epithelial cell growth control and suggest new avenues of investigation to define the role of C/EBPδ and C/EBPδ target genes in mammary tumorigenesis.

Methods

Cell culture and transient transfections

The immortalized, nontransformed MCF-12A and MCF-10A human mammary epithelial cell lines were obtained from American Type Culture Collection. MCF12A and MCF-10A cell lines were cultured in DMEM/F-12 phenol red free media (Invitrogen) supplemented with 5% horse serum, 20 ng/ml human recombinant EGF, 100 ng/ml cholera toxin, 10 μg/ml bovine insulin, 500 ng/ml hydrocortisone, 100 U/ml penicillin and 100 μg/ml streptomycin (Complete Growth media, CGM). Growth arrest was induced by culturing confluent MCF-12A or MCF-10A cells in CGM or switching near confluent cultures to media containing 0.5% horse serum plus antibiotics (Growth arrest media, GAM). MCF-12A cells were transiently transfected with 5 μg of a v5 tagged C/EBPδ expression construct (pCDNA3.1-hC/EBPδ-v5) using the Lipofectamine Plus transfection system (Invitrogen). Three hours later transfected cells were washed with 1× PBS, returned to CGM for 48 hours. All transfection experiments were performed in triplicate and repeated 2–3 times. HC11 cells (mouse immortalized mammary epithelial cell line) were grown in complete growth media (CGM) containing RPMI 1640 medium (Invitrogen) containing 10% FBS and supplemented with 10 ng/ml epidermal growth factor, 10 μg/ml insulin, 50 units/ml penicillin, 50 μg/ml streptomycin and 500 ng/ml fungizone in a humidified incubator at 37°C and 5% CO2. Exponentially growing HC11 cells were cultured at 30–50% confluence in CGM, confluent HC11 cells were grown to confluence and retained in CGM for 48 hours.

Chromatin immunoprecipitation CpG island microarray ("ChIP-Chip") and ChIP assays

Isolation of C/EBPδ-associated genomic DNA was performed using the Chromatin Immunoprecipitation Assay Kit (Upstate) and following Upstate ChIP protocols. Anti-v5 epitope antibody (Invitrogen) (non-cross reactive with endogenous MCF-12A proteins) was used in the primary immunoprecipitation reaction. Mouse nonspecific IgG (Upstate) was used as a non-specific antibody control for the ChIP assays. Briefly, 5 × 106 MCF-12A cells were cross-linked with 1% formaldehyde (10 minutes, 37°C), washed 2× with PBS (4°C), pelleted by centrifugation and resuspended in 200 μl SDS lysis buffer supplemented with protease inhibitors. Cell lysates were sonicated to shear DNA to 0.5–2.0 kb in length (verified by agarose gel analysis). Sonicated lysates were centrifuged to remove debris, diluted 1:10 in dilution buffer and used for IP with 2 μg anti-v5 antibody or nonspecific mouse IgG control. After immunoprecipitation, pellets were washed with 1 ml Low Salt Immune Complex Wash Buffer, High Salt Immune Complex Wash Buffer and LiCl Immune Complex Wash Buffer and TE buffer. Bead precipitates were eluted twice with fresh elution buffer (1% SDS, 0.1 M NaHCO3) and eluates were pooled and heated at 65°C for 4 hours to reverse protein-DNA crosslinks. DNA was purified by phenol extraction and ethanol precipitation. To confirm C/EBPδ/target promoter binding, optimized, nested PCR was performed with 2.5 μl of the 50 μ1 DNA preparation plus promoter specific primers. Specific PCR products were assessed by agarose gel electrophoresis. An optimized two-step PCR amplification was then performed on the ChIP recovered DNA. The first amplification step involved a 3 cycle random primer amplification including: 8 μl ChIP DNA, 2 μ1 5× Sequenase Buffer, 1 μ1 of 40 μM primer A (5'-GTT TCC CAG TCA CGA TCN NNN NNN NN), 1.5 μ1 10 mM DNTP's, and 1 μ1 Sequenase (US Biochemical, Sequenase Kit Ver. 2.0) was incubated at 94°C for 2 min, 10°C for 5 min followed by 37°C for 8 min. The random primer incorporation reactions were then increased to a final volume of 60 l by the addition of 40 l of RNAse/DNAse-free water (Invitrogen). The second amplification step included 15 μ1 of the DNA product from step one, 8 μ1 MgCl2, 10 μ1 10× PCR Buffer, 2 μ1 50× aa-dUTP/dNTP's, 1 μ1 Primer B (5'-GTT TCC CAG TCA CGA TC 100 pm/μ1), 1 μ1 Taq polymerase (QIAGEN) plus 63 μ1 of RNAse/DNAse-free water. The following amplification/nucleotide incorporation program was used: 92°C for 30 s, 40°C for 30 s, 50°C for 30 s, 72°C for 1 min × 34 cycles. A confirmatory agarose gel was run with 5 μ1 of PCR product to visualize the DNA and confirm the size range of ~300–1000 bp in length.

PCR amplified anti-v5 and IgG ChIP isolated DNA was purified using the CyScribe GFX Purification Kit (Amersham, catalogue # 27-9602-02). DNA was resuspended and vortexed in vials containing Alexa 647 (green fluorescent) or Alexa 555 (red fluorescent) dye (Molecular Probes) in 2 μ1 100% DMSO (Sigma). Following complete dissolution of the dye 8 μ1 aa-dUTP was added and the sample was vortexed and incubated for 1 hour at room temperature in the dark. Following dye-coupling, samples were purified separately using the CyScribe GFX Purification Kit (Amersham) and the eluent volume reduced to 5 μ1 for hybridization by SpeedVac (45 min, medium heat setting). Hybridization of the labeled DNA sample to the UHN 12 k Human CpG Arrays was performed by the Ohio State University Comprehensive Cancer Microarray Core Laboratory. Briefly, CPG array slides were prehybridized in a solution containing 100 μ1 of DIG Easy Hyb solution (Roche), 5 μ1 of 10 mg/ml calf thymus DNA (Invitrogen) and 5 μ1 of 10 mg/m1 L yeast tRNA (Invitrogen) at 65°C for 2 min and then cooled to room temperature. The hybridization solution (85 μ1 total volume) containing the pooled Alexa 647 and Alexa 555 labeled DNA was mixed and incubated at 65°C for 2 min, cooled to room temperature and the pipetted onto the CPG array slides. A 24 × 60 mm glass coverslip (Corning) was placed over the hybridization droplet and the arrays was place into a hybridization chamber containing a small amount of DIG Easy Hyb solution in the bottom to maintain a humid environment. The arrays were incubated in a 37°C incubator for 18 hours. After hybridization, the slides were sequentially washed with 1× SSC and 0.1% SDS for 15 min in 50°C water bath, 1× SSC, and 0.1× SSC at room temperature. Slides were spun dry at 640 rpm for 15 min and the fluorescent signal scanned using a GenePix 4000B scanner. For each independent experiment the v5-antibody-ChIP DNA and the mouse IgG-ChIP control DNA fluro dye labeling was swapped to reduce the effect of dye bias on the microarray data. A 2 fold hybridization signal intensity (antiv5 ChIP vs the IgG ChIP) was used to identify C/EBPδ-v5 binding targets. Only those spots satisfying the 2 fold cut-off value in both of the two dye swapping microarray experiments were used for downstream bioinformatics analysis. Array spots with a size (diameter) less than 70% of the normal size or having a signal-to-noise ratio of less than 2.5 fold were eliminated from the analysis. We also determined that no reliable signal was produced from control spots containing Arabidopsis DNA. The conventional ChIP assays were performed by isolation of C/EBPδ-associated (C/EBPδ-v5) genomic DNA using the Chromatin Immunoprecipitation Assay Kit (Upstate) and following Upstate ChIP protocols.

Bioinformatic and statistical analysis

CGI microarray gene information was obtained from the UHN Microarray Center's CpG Island Database http://data.microarrays.ca/cpg/. Genome sequences and annotations were obtained from the UCSC Genome Bioinformatics Site http://genome.ucsc.edu. All CGI hits were mapped to promoter, exonic, intronic, and intergenic regions according to the locations of RefSeq genes. Promoters were defined as 5 kb upstream to the annotated translation start sites. Statistical analysis was performed using Excel based software. Functional gene categories were identified and Functional Annotation Clustering performed using resources available at the Database for Annotation, Visualization and Integrated Discovery (DAVID) http://niaid.abcc.ncifcrf.gov/. Hypothetical genes and genes without GO assignments are not shown. The Alibaba2 program located at the BIOBASE gene regulation website http://www.gene-regulation.com was used to identify potential C/EBP binding sites within the target promoters. Information about C/EBP family transcription factors was obtained from TRANSFAC 7.0-Public database in the BIOBASE website. Three independent experiments were performed.

Reverse transcription -PCR (RT-PCR)

Total RNA was isolated using RNABee (TelTest, Inc.). One g RNA samples were treated with amplification grade DNase I and reverse transcribed with an oligo(dT) primer in 20 μ1 using the SuperScript First-Strand Synthesis System for RT-PCR from Invitrogen. One μ1 cDNA aliquots were amplified by gene specific primers. PCR amplification products were analyzed by agarose gel electrophoresis, and photographed using an Alpha Innotech Imagine System.

mRNA isolation and Real Time PCR

Total mRNA was isolated using RNAzol B (Tel-Test, Inc., Friendswood, TX) according to the manufacturer's protocols. Total mRNA (1 μg) was reverse transcribed using the reverse transcriptase kit (Invitrogen, Carlsbad, CA). The reverse transcription products were amplified by Real-time PCR using the LightCycler® 480 Real-Time PCR System (Roche, Indianapolis, IN). Amplification was performed in a total volume of 20 μL containing 10 μL of a 2×SYBR Green PCR master mix, 0.2 μL of forward and reverse primers and 1 μL cDNA in each reaction. PCR specificity was verified by assessing the melting curves of each amplification product. Real-time PCR data were normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA control. The primers used are presented in Table 2. The fold change in specific mRNA levels was calculated using the comparative CT (ΔΔCT) method. Results presented as mean ± SEM of the fold changes derived from three experiments with triplicate analyses performed for each treatment.

Table 2.

Forward (F-) and reverse (R-) primers for ChIP and RT-PCR assays (human)

Gene name Primers for ChIP Primers for RT-PCR
DIRAS3 F- ctcacaggcaagggagaaag; F- ccgaagggccaagtggaggaagc;
R- tacaggttggggaggaactg R- tggtgaggcagccccgttgtt

ASAHL F- gcagagacacaccagcagag; F- gtggctcaagactccagagg;
R- gtaagccgtggaggaggag R- tgcttcgaagttttccgact

BCAT2 F- aagaggccttgtgaggtcaa; F- ccgctgaatggtgttatcct;
R- ctcgctggaaagagctgagt R- tctccttcagctccttctgg

BCL2L1 F- agagctcttgcgtctggaag, F- agagctcttgcgtctggaag;
R- ggacttctcaatggggttca R- ggacttctcaatggggttca

CCRN4L F- cctgaccatgtctttgctca; F- ctggagcccattgatcctaa;
R- cgcaggcggtctaaaataag R- ggtaggccaggatttcttcc

SEPT7 F- ggagtgtgagctccaagagg; F- aatagttgataccccaggat;
R- cttgcttacgcacgctacag R- gagcaatgaagtataaacaacac

FGF9 F- ctctcgcagtgcatctttca; F- tgagaagggggagctgtatgga;
R- tcccatccgaccgtaataag R- gtgaatttctggtgccgtttagtc

GPR160 F- aaggttgcccgtctctgac; F- gctctcgcttcgtcctacac;
R- gcctcggaaaacaaatagcc R- taggggctggtttgtttgac

ITGB8 F- caagtcctcacacccatcct; F- gctctcgcttcgtcctacac;
R- ccttcccagtaaacggaaca R- taggggctggtttgtttgac

MKL2 F- ctctgtcctgtgtgccattc; F- ctgtcctccccacaaacact;
R- cgtgactgggaagggttaaa R- gatctgcagttgcaggaaca

MSH5 F- atgttcaccgctttgagtcc; F- gagacgctgctgatgtacca;
R- ccagcctagagatccgacag R- cctgatgagttgggtccagt

OXA1L F- agcctcccaaagtgatgaga; F- agaatgatgcccctgataacctt;
R- gtcgcgattgtcctctgatt R- gacgcgtcatttcagcatttttc

SCAP2 F- cgagctcagaggccatcgtagggt; F- ctcccaaagatgctgaaga;
R- gaagatcttcccggccccagaaga R- tgcttgttagtggattgcttat

VDR F- ctggatgattttgtgagca; F- cagtttgggaggtcgaggta;
R- aattttcatcgaccgtcgtc R- gaatgagagtgggggtctga

Abbreviations

(C/EBPδ): CCAAT/Enhancer Binding Proteinδ; (ChIP-chip): chromatin immunoprecipitation-microarray chip; (MECs): mammary epithelial cells: UHN: University Health Network; HCG12K: Human CpG Island 12 K.

Authors' contributions

YZ and JDW developed the experimental design. YZ performed cell culture, transfection, ChIP-chip, and RT-PCR luciferase assays. TL performed cell culture and Real-Time PCR assays. THMH pioneered the development of the ChIP-chip technology, provided CpG island arrays and extensive advice. PY provided technical advice in the design and implementation of the ChIP-chip assays, performed microarray hybridizations and assisted in the interpretation of the data. TJDW and YZ were the primary authors of the manuscript, however, all authors read and contributed to the final manuscript.

Acknowledgments

Acknowledgements

This work was funded in part by the National Institutes of Health (CA57607-14) (to JD), OSUCCC P30 CA16058 (TH and JD) and the Ohio State College of Veterinary Medicine C. Glen Barber Fund (YZ).

Contributor Information

Yingjie Zhang, Email: zhang.321@osu.edu.

Tong Liu, Email: liu.756@osu.edu.

Pearlly Yan, Email: Yan.342@osu.edu.

Tim Huang, Email: huang.434@osu.edu.

Jim DeWille, Email: dewille.1@osu.edu.

References

  1. Ramji DP, Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J. 2002;365:561–575. doi: 10.1042/BJ20020508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Vinson C, Myakishev M, Acharya A, Mir AA, Moll JR, Bonovich M. Classification of human B-ZIP proteins based on dimerization properties. Mol Cell Biol. 2002;22:6321–6335. doi: 10.1128/MCB.22.18.6321-6335.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Johnson PF. Molecular stop signs: regulation of cell-cycle arrest by C/EBP transcription factors. J Cell Sci. 2005;118:2545–2555. doi: 10.1242/jcs.02459. [DOI] [PubMed] [Google Scholar]
  4. O'Rourke J, Yuan R, DeWille J. CCAAT/enhancer-binding protein-delta (C/EBP-delta) is induced in growth-arrested mouse mammary epithelial cells. J Biol Chem. 1997;272:6291–6296. doi: 10.1074/jbc.272.10.6291. [DOI] [PubMed] [Google Scholar]
  5. O'Rourke JP, Newbound GC, Hutt JA, DeWille J. CCAAT/enhancer-binding protein delta regulates mammary epithelial cell G0 growth arrest and apoptosis. J Biol Chem. 1999;274:16582–16589. doi: 10.1074/jbc.274.23.16582. [DOI] [PubMed] [Google Scholar]
  6. O'Rourke JP, Hutt JA, DeWille J. Transcriptional regulation of C/EBPdelta in G(0) growth-arrested mouse mammary epithelial cells. Biochem Biophys Res Commun. 1999;262:696–701. doi: 10.1006/bbrc.1999.1256. [DOI] [PubMed] [Google Scholar]
  7. Hutt JA, O'Rourke JP, DeWille J. Signal transducer and activator of transcription 3 activates CCAAT enhancer-binding protein delta gene transcription in G0 growth-arrested mouse mammary epithelial cells and in involuting mouse mammary gland. J Biol Chem. 2000;275:29123–29131. doi: 10.1074/jbc.M004476200. [DOI] [PubMed] [Google Scholar]
  8. Hutt JA, DeWille JW. Oncostatin M induces growth arrest of mammary epithelium via a CCAAT/enhancer-binding protein delta-dependent pathway. Mol Cancer Ther. 2002;1:601–610. [PubMed] [Google Scholar]
  9. Sivko GS, DeWille JW. CCAAT/Enhancer binding protein delta (c/EBPdelta) regulation and expression in human mammary epithelial cells: I. "Loss of function" alterations in the c/EBPdelta growth inhibitory pathway in breast cancer cell lines. J Cell Biochem. 2004;93:830–843. doi: 10.1002/jcb.20223. [DOI] [PubMed] [Google Scholar]
  10. Sivko GS, Sanford DC, Dearth LD, Tang D, DeWille JW. CCAAT/Enhancer binding protein delta (c/EBPdelta) regulation and expression in human mammary epithelial cells: II. Analysis of activating signal transduction pathways, transcriptional, post-transcriptional, and post-translational control. J Cell Biochem. 2004;93:844–856. doi: 10.1002/jcb.20224. [DOI] [PubMed] [Google Scholar]
  11. Tang D, Sivko GS, Dewille JW. C/EBPdelta (CEBPD) gene expression in the SUM-52PE human breast cancer cell line and in primary breast tumors. Breast Cancer Res Treat. 2005. pp. 1–10. [DOI] [PubMed]
  12. Gery S, Tanosaki S, Hofmann WK, Koppel A, Koeffler HP. C/EBPdelta expression in a BCR-ABL-positive cell line induces growth arrest and myeloid differentiation. Oncogene. 2005;24:1589–1597. doi: 10.1038/sj.onc.1208393. [DOI] [PubMed] [Google Scholar]
  13. Huang AM, Montagna C, Sharan S, Ni Y, Ried T, Sterneck E. Loss of CCAAT/enhancer binding protein delta promotes chromosomal instability. Oncogene. 2004;23:1549–1557. doi: 10.1038/sj.onc.1207285. [DOI] [PubMed] [Google Scholar]
  14. Vegesna V, Takeuchi S, Hofmann WK, Ikezoe T, Tavor S, Krug U, Fermin AC, Heaney A, Miller CW, Koeffler HP. C/EBP-beta, C/EBP-delta, PU.1, AML1 genes: mutational analysis in 381 samples of hematopoietic and solid malignancies. Leuk Res. 2002;26:451–457. doi: 10.1016/S0145-2126(01)00150-3. [DOI] [PubMed] [Google Scholar]
  15. Tang D, DeWille J. Detection of base sequence changes in the CEBPD gene in human breast cancer cell lines and primary breast cancer isolates. Mol Cell Probes. 2003;17:11–14. doi: 10.1016/S0890-8508(02)00112-3. [DOI] [PubMed] [Google Scholar]
  16. Porter D, Lahti-Domenici J, Keshaviah A, Bae YK, Argani P, Marks J, Richardson A, Cooper A, Strausberg R, Riggins GJ, et al. Molecular markers in ductal carcinoma in situ of the breast. Mol Cancer Res. 2003;1:362–375. [PubMed] [Google Scholar]
  17. Porter DA, Krop IE, Nasser S, Sgroi D, Kaelin CM, Marks JR, Riggins G, Polyak K. A SAGE (serial analysis of gene expression) view of breast tumor progression. Cancer Res. 2001;61:5697–5702. [PubMed] [Google Scholar]
  18. Agrawal S, Hofmann WK, Tidow N, Ehrich M, Boom D van den, Koschmieder S, Berdel WE, Serve H, Muller-Tidow C. The C/EBPdelta tumor suppressor is silenced by hypermethylation in acute myeloid leukemia. Blood. 2007;109:3895–3905. doi: 10.1182/blood-2006-08-040147. [DOI] [PubMed] [Google Scholar]
  19. Gigliotti AP, DeWille JW. Local signals induce CCAAT/enhancer binding protein-delta (C/EBP-delta) and C/EBP-beta mRNA expression in the involuting mouse mammary gland. Breast Cancer Res Treat. 1999;58:57–63. doi: 10.1023/A:1006381906288. [DOI] [PubMed] [Google Scholar]
  20. Gigliotti AP, DeWille JW. Lactation status influences expression of CCAAT/enhancer binding protein isoform mRNA in the mouse mammary gland. J Cell Physiol. 1998;174:232–239. doi: 10.1002/(SICI)1097-4652(199802)174:2<232::AID-JCP10>3.0.CO;2-E. [DOI] [PubMed] [Google Scholar]
  21. Gigliotti AP, Johnson PF, Sterneck E, DeWille JW. Nulliparous CCAAT/enhancer binding proteindelta (C/EBPdelta) knockout mice exhibit mammary gland ductal hyperlasia. Exp Biol Med (Maywood) 2003;228:278–285. doi: 10.1177/153537020322800306. [DOI] [PubMed] [Google Scholar]
  22. Clarkson RW, Boland MP, Kritikou EA, Lee JM, Freeman TC, Tiffen PG, Watson CJ. The genes induced by signal transducer and activators of transcription (STAT)3 and STAT5 in mammary epithelial cells define the roles of these STATs in mammary development. Mol Endocrinol. 2006;20:675–685. doi: 10.1210/me.2005-0392. [DOI] [PubMed] [Google Scholar]
  23. Cantwell CA, Sterneck E, Johnson PF. Interleukin-6-specific activation of the C/EBPdelta gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol. 1998;18:2108–2117. doi: 10.1128/mcb.18.4.2108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li B, Si J, Dewille JW. Ultraviolet radiation (UVR) activates p38 MAP kinase and induces post-transcriptional stabilization of the C/EBPdelta mRNA in G(0) growth arrested mammary epithelial cells. J Cell Biochem. 2007. [DOI] [PubMed]
  25. Zhou S, Dewille JW. Proteasome-mediated CCAAT/enhancer-binding protein delta (C/EBPdelta) degradation is ubiquitin-independent. Biochem J. 2007;405:341–349. doi: 10.1042/BJ20061873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kirmizis A, Farnham PJ. Genomic approaches that aid in the identification of transcription factor target genes. Exp Biol Med (Maywood) 2004;229:705–721. doi: 10.1177/153537020422900803. [DOI] [PubMed] [Google Scholar]
  27. Wu J, Smith LT, Plass C, Huang TH. ChIP-chip Comes of Age for Genome-wide Functional Analysis. Cancer Res. 2006;66:6899–6902. doi: 10.1158/0008-5472.CAN-06-0276. [DOI] [PubMed] [Google Scholar]
  28. Balda MS, Matter K. Epithelial cell adhesion and the regulation of gene expression. Trends Cell Biol. 2003;13:310–318. doi: 10.1016/S0962-8924(03)00105-3. [DOI] [PubMed] [Google Scholar]
  29. Cambier S, Mu DZ, O'Connell D, Boylen K, Travis W, Liu WH, Broaddus VC, Nishimura SL. A role for the integrin alphavbeta8 in the negative regulation of epithelial cell growth. Cancer Res. 2000;60:7084–7093. [PubMed] [Google Scholar]
  30. Fjellbirkeland L, Cambier S, Broaddus VC, Hill A, Brunetta P, Dolganov G, Jablons D, Nishimura SL. Integrin alphavbeta8-mediated activation of transforming growth factor-beta inhibits human airway epithelial proliferation in intact bronchial tissue. Am J Pathol. 2003;163:533–542. doi: 10.1016/s0002-9440(10)63681-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kaneda A, Wakazono K, Tsukamoto T, Watanabe N, Yagi Y, Tatematsu M, Kaminishi M, Sugimura T, Ushijima T. Lysyl oxidase is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in human gastric cancers. Cancer Res. 2004;64:6410–6415. doi: 10.1158/0008-5472.CAN-04-1543. [DOI] [PubMed] [Google Scholar]
  32. Payne SL, Fogelgren B, Hess AR, Seftor EA, Wiley EL, Fong SF, Csiszar K, Hendrix MJ, Kirschmann DA. Lysyl oxidase regulates breast cancer cell migration and adhesion through a hydrogen peroxide-mediated mechanism. Cancer Res. 2005;65:11429–11436. doi: 10.1158/0008-5472.CAN-05-1274. [DOI] [PubMed] [Google Scholar]
  33. Dai P, Xiong WC, Mei L. Erbin inhibits RAF activation by disrupting the sur-8-Ras-Raf complex. J Biol Chem. 2006;281:927–933. doi: 10.1074/jbc.M507360200. [DOI] [PubMed] [Google Scholar]
  34. Ropke A, Buhtz P, Bohm M, Seger J, Wieland I, Allhoff EP, Wieacker PF. Promoter CpG hypermethylation and downregulation of DICE1 expression in prostate cancer. Oncogene. 2005;24:6667–6675. doi: 10.1038/sj.onc.1208824. [DOI] [PubMed] [Google Scholar]
  35. Nagpal S, Na S, Rathnachalam R. Noncalcemic actions of vitamin D receptor ligands. Endocr Rev. 2005;26:662–687. doi: 10.1210/er.2004-0002. [DOI] [PubMed] [Google Scholar]
  36. Wietzke JA, Ward EC, Schneider J, Welsh J. Regulation of the human vitamin D3 receptor promoter in breast cancer cells is mediated through Sp1 sites. Mol Cell Endocrinol. 2005;230:59–68. doi: 10.1016/j.mce.2004.11.001. [DOI] [PubMed] [Google Scholar]
  37. Ikezoe T, Gery S, Yin D, O'Kelly J, Binderup L, Lemp N, Taguchi H, Koeffler HP. CCAAT/enhancer-binding protein delta: a molecular target of 1,25-dihydroxyvitamin D3 in androgen-responsive prostate cancer LNCaP cells. Cancer Res. 2005;65:4762–4768. doi: 10.1158/0008-5472.CAN-03-3619. [DOI] [PubMed] [Google Scholar]
  38. Stein T, Morris JS, Davies CR, Weber-Hall SJ, Duffy MA, Heath VJ, Bell AK, Ferrier RK, Sandilands GP, Gusterson BA. Involution of the mouse mammary gland is associated with an immune cascade and an acute-phase response, involving LBP, CD14 and STAT3. Breast Cancer Res. 2004;6:R75–91. doi: 10.1186/bcr753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Boise LH, Gonzalez-Garcia M, Postema CE, Ding L, Lindsten T, Turka LA, Mao X, Nunez G, Thompson CB. bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell. 1993;74:597–608. doi: 10.1016/0092-8674(93)90508-N. [DOI] [PubMed] [Google Scholar]
  40. Akgul C, Moulding DA, Edwards SW. Alternative splicing of Bcl-2-related genes: functional consequences and potential therapeutic applications. Cell Mol Life Sci. 2004;61:2189–2199. doi: 10.1007/s00018-004-4001-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Walton KD, Wagner KU, Rucker EB, 3rd, Shillingford JM, Miyoshi K, Hennighausen L. Conditional deletion of the bcl-x gene from mouse mammary epithelium results in accelerated apoptosis during involution but does not compromise cell function during lactation. Mech Dev. 2001;109:281–293. doi: 10.1016/S0925-4773(01)00549-4. [DOI] [PubMed] [Google Scholar]
  42. Heermeier K, Benedict M, Li M, Furth P, Nunez G, Hennighausen L. Bax and Bcl-xs are induced at the onset of apoptosis in involuting mammary epithelial cells. Mech Dev. 1996;56:197–207. doi: 10.1016/0925-4773(96)88032-4. [DOI] [PubMed] [Google Scholar]
  43. Zhang T, Delestienne N, Huez G, Kruys V, Gueydan C. Identification of the sequence determinants mediating the nucleo-cytoplasmic shuttling of TIAR and TIA-1 RNA-binding proteins. J Cell Sci. 2005;118:5453–5463. doi: 10.1242/jcs.02669. [DOI] [PubMed] [Google Scholar]
  44. Le Guiner C, Gesnel MC, Breathnach R. TIA-1 or TIAR is required for DT40 cell viability. J Biol Chem. 2003;278:10465–10476. doi: 10.1074/jbc.M212378200. [DOI] [PubMed] [Google Scholar]
  45. Konishi T, Sasaki S, Watanabe T, Kitayama J, Nagawa H. Overexpression of hRFI inhibits 5-fluorouracil-induced apoptosis in colorectal cancer cells via activation of NF-kappaB and upregulation of BCL-2 and BCL-XL. Oncogene. 2006;25:3160–3169. doi: 10.1038/sj.onc.1209342. [DOI] [PubMed] [Google Scholar]
  46. Ray A, Ray BK. Serum amyloid A gene expression under acute-phase conditions involves participation of inducible C/EBP-beta and C/EBP-delta and their activation by phosphorylation. Biochem Biophys Res Commun. 1999;266:677–683. doi: 10.1006/bbrc.1999.1885. [DOI] [PubMed] [Google Scholar]
  47. Poli V. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J Biol Chem. 1998;273:29279–29282. doi: 10.1074/jbc.273.45.29279. [DOI] [PubMed] [Google Scholar]
  48. Cao Z, Umek RM, McKnight SL. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 1991;5:1538–1552. doi: 10.1101/gad.5.9.1538. [DOI] [PubMed] [Google Scholar]
  49. Lane MD, Tang QQ, Jiang MS. Role of the CCAAT enhancer binding proteins (C/EBPs) in adipocyte differentiation. Biochem Biophys Res Commun. 1999;266:677–683. doi: 10.1006/bbrc.1999.1885. [DOI] [PubMed] [Google Scholar]
  50. Barbaro V, Testa A, Di Iorio E, Mavilio F, Pellegrini G, De Luca M. C/EBPdelta regulates cell cycle and self-renewal of human limbal stem cells. J Cell Biol. 2007;177:1037–1049. doi: 10.1083/jcb.200703003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. DeWille JW, Farmer SJ. Linoleic acid controls neonatal tissue-specific stearoyl-CoA desaturase mRNA levels. Biochim Biophys Acta. 1993;1170:291–295. doi: 10.1016/0005-2760(93)90012-x. [DOI] [PubMed] [Google Scholar]
  52. Sterneck E, Paylor R, Jackson-Lewis V, Libbey M, Przedborski S, Tessarollo L, Crawley JN, Johnson PF. Selectively enhanced contextual fear conditioning in mice lacking the transcriptional regulator CCAAT/enhancer binding protein delta. Proc Natl Acad Sci USA. 1998;95:10908–10913. doi: 10.1073/pnas.95.18.10908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Hudson R, Taniguchi-Sidle A, Boras K, Wiggan O, Hamel PA. Alx-4, a transcriptional activator whose expression is restricted to sites of epithelial-mesenchymal interactions. Dev Dyn. 1998;213:159–169. doi: 10.1002/(SICI)1097-0177(199810)213:2<159::AID-AJA1>3.0.CO;2-F. [DOI] [PubMed] [Google Scholar]

Articles from BMC Molecular Biology are provided here courtesy of BMC

RESOURCES