Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Schematic diagram of the GHSR gene demonstrating the common SNPs identified by sequencing of 70 French obese children. The three haplotype-tagging SNPs genotyped in the UK population studies are indicated by solid triangles and bold type. Only SNP C231G (ttccgcgagctgcgcaccacc/gaccaacctctacctgtccag) is not annotated in HAPMAP Build 35.
