Table 1.

PCR primers and conditions

Primer
Pair	Name	Sequence	Position	Concentration	Region amplified	PCR conditions
	new5′x2	5′GTCTCTGGCTTGAGGGACAG	intron 1, 180 bp upstream of exon 2	300 nm	intron 1-exon 5, M genes only	94°C 5 min; 94°C 1 min,
1						62°C 30 sec, 72°C 5 min,
	3′greenx5	5′CAGCAGAATGCCAGGACCATC	M gene exon 5	300 nm		37 cycles; 72°C 20 min, 4°C hold
	new5′x2	5′GTCTCTGGCTTGAGGGACAG	intron 1, 180 bp upstream of exon 2	300 nm	intron 1-exon 5, L genes only	94°C 5 min; 94°C 1 min,
2						62°C 30 sec, 72°C 5 min,
	3′redx5	5′GCAGTACGCAAAGATCATCACC	L gene exon 5	300 nm		37 cycles; 72°C 20 min, 4°C hold
	5′exon2	5′CTCGAATTCGGTGCTGCAGCCGAGCTCC	55bp upstream of exon 2	600 nm	exon 2	95°C 9 min 1 cycle;
3						94°C 45 sec, 68°C 1 min 40 cycles;
	3′exon2	5′CTCGAATTCGAGCCTGGGCCCCGACTGGC	30 bp downstream of exon 2	600 nm		72°C 10 min, 4°C hold
	In2ul36x3F	5′CAGAGTCTGACCCTGCCCACT	intron 2, 136 bp upstream of exon 3	300 nm	exon 3	94°C 5 min; 94°C 45 sec,
4						61°C 45 sec, 72°C 45 sec 30 cycles;
	In3dn46x3R	5′TGTCGTTTTTTCCACCTCAGTCC	intron 3, 46 bp downstream of exon 3	300 nm		72°C 10 min, 4°C hold
	In3up23x4F	5′TTGAGGGCAGAGCAGCTTAGG	intron 3, 23bp upstream of exon 4	300 nm	exon 4	94°C 5 min; 94°C 45 sec,
5						62°C 45 sec, 72°C 45 sec 30 cycles;
	In4dn62x4R	5′TGGCTGCCGGCCCTTC	intron 4, 62bp dwnstrm of exon 4	300 nm		72°C 10 min, 4°C hold
	340-362	5′CAGCCACCCAGCCTCCAC	160 bp upstream of ATG start codon, all genes	300 nm	exon 1	95°C 9 min 1 cycle; 94°C 30 sec,
6						61°C 15 sec, 72°C 30 sec, 30 cycles;
	In1dn35x1R	5′AGTCCCAGGCCCAATTAAGAGAT	intron 1, 35 bp dwnstrm of exon 1	300 nm		72°C 7 min, 4°C hold
	In5up42x6F	5′GGAGAGGTGGCCAAAGCCC	intron 5, 42bp upstrm of exon 6	300 nm	exon 6	94°C 5 min; 94°C 30 sec,
7						63°C 15 sec, 72°C 30 sec 30 cycles;
	In6dn51x6R	5′ACCCTTCCCTGCTCTGCTCAA	intron 6, 51bp dwnstrm of exon 6	300 nm		72°C 10 min, 4°C hold
	5′exon5	5′ACGGTATTTTGAGTGGGATCTGCT	intron 4, 35bp upstream of exon 5	300 nm	exon 5	94°C 9 min; 94°C 45 sec,
8						59°C 45 sec. 72°C 45, 37 cycles;
	3′exon5	5′TCCACCCCCCGACTCACTATCC	intron 5, 40 bp downstream of exon 5	300 nm		72°C 10 min, 4°C hold
	upstrmgrnFd	5′CCTGCAAGTGGGAATCTAAACAGA	793 bp upstream of start codon of downstream genes	100 nm	downstream gene promoter	95°C 5 min 1 cycle; 94°C 1 min,
9						60°C 1 min sec, 72°C 1.5 min,
	565-545exl	5′TGGGTGCTGTCCTCATAGCTG	exon 1, 70 bp downstream of start codon	300 nm		40 cycles; 72°C 10 min, 4°C hold