Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for mutagenesis of inhibin βB-subunit cleavage site
| Mutation | Sequence (5′ → 3′) |
|---|---|
| IRKR → IRKA | atcgcactccaggccagccttgcgaatgcggtgcctgctgtc |
| gacagcaggcaccgcattcgcaaggctggcctggagtgcgat | |
| IRKR → IRAA | atcgcactccaggccagcagcgcgaatgcggtgcctgctgtc |
| gacagcaggcaccgcattcgcgctgctggcctggagtgcgat | |
| IRKR → IAAA | atcgcactccaggccagcagcagcaatgcggtgcctgctgtc |
| gacagcaggcaccgcattgctgctgctggcctggagtgcgat |
