Table 1.
PCR and sequencing primers for assessing four VKORC1 SNPs by pyrosequencing.
SNP ID | Primers | Primer sequence |
---|---|---|
rs17886199 | Forward | 5′CCCCACTCCTAGCAATCTTGGTG3′ |
Reverse | Biotin-5′CTCACTTTGGGCAACAGAGCCAG3′ | |
Sequencing | 5′GTCTTTTAATTGGTTTAAG3′ | |
rs9923231 | Forward | 5′TGTTGGCCAGGCTTGTCTTAAAC3′ |
Reverse | Biotin-5′AGCCAGCAGGAGAGGGAAATATC3′ | |
Sequencing | 5′GCGTGAGCCACCGCA3′ | |
rs7196161 | Forward | 5′ATGTGAGACAGTCCCACTCTGC3′ |
Reverse | Biotin-5′TGTAATCCCAGCACTTTAGGAAGCCA3′ | |
Sequencing | 5′ACTCCTGACCTCATGATC3′ | |
rs17878338 | Forward | 5′CCGACCTCAGGTGATCTGCC3′ |
Reverse | Biotin-5′CAGAGGCAGCTGTGGGTAAGG3′ | |
Sequencing | 5′CTGCTTTGGCCTCCC3′ |
PCR conditions for rs17878338 and rs9923231 were an initial denaturation of 96°C for 5 min followed by 35 cycles of 94°C for 20 s, 56°C for 20 s, and 72°C for 15 s. PCR conditions for rs17886199 were similar except that 60°C was used as the annealing temperature. Amplification of rs7196161 required a two-step ‘touchdown’ PCR reaction. Following denaturation, the annealing temperature was decreased 1°C every two cycles from 63°C down to 57°C. The second phase consisted of 30 cycles with a final annealing temperature of 56°C.