Table 2.
PCR Primers and Conditions
| name | sequence, 5′ ⇒ 3′1 | amino acids encoded, changes from B31 M1 sequence2 | PCR conditions: annealing temp(Ta), [MgCl2]3 |
|---|---|---|---|
| oMal 01 | cgctttctggtatgccgtgcgta | NA | 48°C, 4 mM |
| oMal 02 | tctcatccgccaaaacagccaag | NA | |
| BB0108F1 | gagaggatccactggttttgattctaaggttgata | 38–333, I46L | 54°C, 3.5 mM |
| BB0108R2 | gagagtcgacttaggaatccaagatttgtatatttgc | ||
| BB0463F (NDPKF) | gagaggatccactttatgtattgttaagccagatgga | 8–169 | 49°C, 2 mM |
| BB0463R (NDPKR) | gagagtcgacttaacaataataatgctcacattcatcatc | ||
| BB0844F | gagaggatccatgcaagacaagaacgtgaaa | 32–314 | 58°C, 2 mM |
| BB0844R3 | ggaggtcgacttatctatcgccactagaaaagattttgct | ||
| BBB07F2 | gagaggatccagtgctcattttggatttactca | 25–357, N257D | 52°C, 3.5 mM |
| BBB07R1 | agagtcgacttattcccaaggttctattttttcaa |
Restriction endonuclease sites used for cloning are underlined.
Amino acids that were changed from the B31 clone M1 sequence (http://cmr.tigr.org/tigr-scripts/CMR/GenomePage.cgi?database=gbb) in all clones sequenced and therefore likely to represent polymorphisms between B. burgdorferi strains B31 M1 and N40 D10E9.
All reactions were conducted as follows: 95°C 15 min, 92° 30 sec., Ta 1 min, 72° 1 min, cycle 40 x, 72°C 7 min. The [MgCl2] listed is the final concentration and includes both that present in the manufacturer’s buffer and that added according to optimization for each primer set. The conditions listed for the forward (F) primer were used for amplifications with the reverse (R) primer listed immediately below.