. 2008 Oct 13;52(12):4407–4419. doi: 10.1128/AAC.00447-08

TABLE 2.

Primers used in the present study

Primer application	Primer pair(s)	Nucleotide sequence (5′-3′)	Nucleotide coordinates	SCCmec region amplified	Reference
Amplification and sequencing of the SCCmec IID remnant	IRLII F	CTCTGCGTATCAGTTAATGA	4684-4703^a	Left chromosomal/SCCmec junction to ccrA2	59
	ccrA R	GCTTCGATAGCCTGTTTCTG	25490-25471^a		59
	ccrA2 F5	AACTTATCGAGATATTAGCC	25265-25284^a	ccrA2 to Tn554	This study
	Tn554 R	AAGCTATCCACGTTCAATCTCAAC	32442-32419^a		59
	N044 F	AAATAGTATAATGCTCGGTC	30481-30500^a	N044 to Tn554	This study
	TN554 R6	TGGAGACATATTAGACACAA	36440-36421^a		This study
	Tn554 F7	GCGATAAAGGACAGTGACTT	36191-36210^a	Tn554 to mecI	This study
	mecI R2	AGGAAACAATCAAGTCGTTG	42507-42488^a		This study
	mecI P2	ATCAAGACTTGCATTCAGGC	42428-42447^a	mecI to dcs	47
	dcs R1	AGACGAAGATAAGAAAGAAC	56433-56414^a		This study
	dcs F	GTCAATGAGATCATCTACAT	56109-56128^a	dcs to right chromosomal/SCCmec junction	59
	orfX R	CCCAAGGGCAAAGCGAC	57826-57810^a		59
Amplification of ccrAB4 from SCC-CI in S. epidermidis from historic Irish nosocomial ST8-t190 MRSA isolates	α4.3	AGCGTATGAATCAAAA	27155-27170^b	ccrA4 to ccrB4 of S. epidermidis SCC-CI	This study
	β4.3	CGATGACAAATTAAAAT	27907-27891^b		This study
Determination of the location of ccrAB4 in GrMSSA isolates with the SCCmec IID remnant and in MRSA isolates	ccrB4 F	TTTCGTCCATTACCTACATC	27075-27056^b	ccrB4 to left chromosomal/SCCmec IID remnant junction	This study
	LCIVb R	TGAGGAGTTTAACAAGTTAT	160-141^c		This study
Determination of the location of ccrAB4 in GrMSSA isolates with ccrAB4 only	ccrB4 F	TTTCGTCCATTACCTACATC	27075-27056^b	ccrB4 to orfX	This study
	orfX R	CCCAAGGGCAAGCGAC	57826-57810^a		59
Determination of the location of dcs in the GrMSSA isolate with dcs only	dcs F	GTCAATGAGATCATCTACAT	56109-56128^a	dcs to orfX	59
	orfX R	CCCAAGGGCAAGCGAC	57826-57810^a		59

Nucleotide coordinates from the type II SCCmec type element, accession number D86934.

Nucleotide coordinates from the Staphylococcus epidermidis ATCC 12228 composite island SCC-CI, accession number BK001539.

Nucleotide coordinates from the SCCmec IID remnant, accession number AM983545.