. Author manuscript; available in PMC: 2009 Dec 1.

Published in final edited form as: Bioorg Med Chem Lett. 2008 Sep 30;18(23):6255–6258. doi: 10.1016/j.bmcl.2008.09.093

Table 1.

Bandage sequences and melting temperatures in °C, hybridized to target RNA (Tg).

Bandage	Sequence 5′-(a-PL-b)– 3′	Bases Targeted		T_m		T_m(a-PL-b)	ΔT_m^a

		A	b	a	b
1	CAUGGUGUCUAGCCAG ^b	24 ← 17	16 ← 9	28.2	30.1	62.2	32
2	GCCAUGGUGUCUAGCCAGCU	26 ← 17	16 ← 7	38.2	52.8	72.4	20
3	CAUGGUGUCUAGCCAGCUUGGGUC	24 ← 13	12 ← 1	42.4	57.3	81.2	24
4	UGGUGU_ _ _ _CCAGCUUGGGUC	22 ← 17	12 ← 1	< 20	57.3	63.4	6
Tg	3′ – CGGUACCACAGAUCGGUCGAACCCAG – 5′

ΔT_m represents the difference between T_m (a-PL-b) and the T_m of the a or b strand, whichever has the higher T_m when hybridized to Tg.

The a strand is in regular font and the b strand is in bold, with the photocleavable linker (PL) connecting the 3′ end of a with the 5′ end of b.