Table 1. Sequence of the three novel miRNAs identified in adult S. japonicum and their locations within the published chromosomal sequence.
| miRNA | Sequence | Size (nt) | S. japonicum contig (LSBI, Shanghai)a | S.mansoni shortgun reads (Sanger)b | Clonesc | ΔG°folding (kcal/mole) |
| sja-let-7 | GGAGGUAGUUCGUUGUGUGGU | 21 | CNUS0000067197: 5856–5876 | shisto12670f07: 651–671 | 5 | −30.8 |
| sja-miR-71 | UGAAAGACGAUGGUAGUGAGA | 21 | CNUS0000007682(-)d: 3100–3120 | shisto8708d10: 353–372 | 1 | −34.5 |
| sja-bantam | UGAGAUCGCGAUUAAAGCUGGU | 22 | CNUS0000021739: 2223–2244 | shisto5226g02(-)d: 325–346 | 6 | −22.9 |
| sja-miR-125 | UCCCUGAGACCCUUUGAUUGUC | 22 | CNUS0000024724:7691–7712 | Smp_contig001766:3162–3183 | 2 | −25.6 |
| sja-miR-new1 | UCCCUGAGACUGAUAAUUGCUC | 22 | CCON0000000380 (-)d:353325–353346:15–36 | shisto8125f02.p1k | 4 | −29.2 |
a
location of the miRNA sequence within the published chromosomal sequence of S. japonicum.
b
location of the miRNA sequence within the published chromosomal sequence of S.mansoni.
c
the number of clones pf each type found in our library of S. japonicum small RNAs.
d
the “-” notation indicates miRNA sequence produced from reported chromosomal sequence.
e
the delta G indicated the stability of the pre-miRNA hairpin.