Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
SNP-specific PCR primers
| Common Forward primer (HIS42-F): SNP769 | GAAATATAATGCCAATGAAA |
| Allele 1-specific primer | ACCATAAACTGAATCACATG |
| Allele 2-specific primer (ON-F) SNP929 | ACAATAAACTGAATCACATC |
| Allele 1-specific primer (OFF-NF) | TAAACGTTTAGTGTAGGACA |
| Allele 2-specific primer | TAAACGTTTAGTGTAGGACC |
