Skip to main content
. 2008 Nov 19;8:201. doi: 10.1186/1471-2180-8-201

Table 3.

oligonucleotides used

Name Sequence Origin/use
MRG-27 TAATAACATATGGCGCTGAAGCTTCACTTGAGGGAG Reverse oligonucleotide for cloning the pstS promoter. The sequence recognized by NdeI is underlined.

MRG-28 TTTTTAGATCTCAGCCCCGGGACCGGGCCCT Forward oligonucleotide for cloning the pstS promoter. It was designed at the end of SCO4143 that is upstream from the pstS gene. The sequence recognized by BglII is underlined.

MRG-34 TTTTTCTAGATCAGCTCAGGCCCGAGATGGTC Reverse oligonucleotide to clone the region of pstS gene that encodes the secreted PstS protein. It contains a XbaI site for cloning.

RS005 CCTTCGGCGCCTTCATCTCATC Forward oligonucleotide of the S. lividans pstS promoter from nucleotide -112 to -91. Used in a PCR to delete the PHO boxes.

RS007 GATGAGATGAAGGCGCCGAAGGGGACGGTGCGGTGAGGTCAC Reverse oligonucleotide to delete the PHO boxes in pstS promoter (from nucleotide -141 to -113). The oligonucleotide contains from nucleotide -161 to -142 and from -112 to -91.

RS008 ATCCCCCGGGAGCAACATCAAGTGCGACGACGCC Forward oligonucleotide to clone the region of pstS gene that encodes the secreted PstS protein. It contains a SmaI site for cloning.

RS009 TCCCCCGGGCCACAGGGGTTCACCCGGCG Forward oligonucleotide of the S. lividans pstS promoter from nucleotide -143 to -124. Used to delete the 186 bp region upstream from the PHO boxes in a PCR with Oli MRG-27. It contains a SmaI site for cloning.

AE007 GCCTGGGTCAAGCAGTACGTCG Forward oligonucleotide of the S. lividans pstS gene from nucleotide +199 to +220. Used in RT-PCR analysis.

AE008 GATGGCGCCGGGGGTCTGCTT Reverse oligonucleotide of S. lividans pstS gene from nucleotide +715 to +735. Used in RT-PCR analysis.

AE024 TCGTCGGGCTGGAGATAGGG Forward of S. lividans phoP gene from nucleotide +254 to +273. Used in RT-PCR analysis.

AE025 CGTGGACGTCGAGGGTCTTG Reverse oligonucleotide of S. lividans phoP gene from nucleotide +561 to +580. Used in RT-PCR analysis.

16S F TCACGGAGAGTTTGATCCTGGCTC Forward oligonucleotide of S. lividans 16S gene from nucleotide +20 to +44. Used in RT-PCR analysis.

16S R CCCGAAGGCCGTCATCCCTCACGC Reverse oligonucleotide of S. lividans 16S gene from nucleotide +436 to +460. Used in RT-PCR analysis.

MRG-30 GCCATCGACGCCTGGGTCAAG Forward oligonucleotide of S. lividans pstS gene from nucleotide +189 to +210. Used to obtain pstS probe for Northern blot analysis.

MRG-31 CAGGCCCGAGATGGTCTCGCG Reverse oligonucleotide of S. lividans pstS gene from nucleotide +1086 to +1107. Used to obtain pstS probe for Northern blot analysis.